Morchella angusticeps

Peck · species

image placeholder — illustration coming later

Fungi/Ascomycota/Pezizomycetes/Pezizales/Morchellaceae/Morchella

At a glance

Occurrence records890

Data sources11

Biological traits0

DNA specimens12

eDNA detections13

Sources11 archives

Databases and archives Morchella angusticeps's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility890 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS21 compounds

Occurrence & distributionGBIF890 records

Environmental DNA2 datasets · 3 countries13 detections

DNA & barcodingBOLD · NCBI12 specimens

Genome at a glanceGoaT · NCBI57 Mbp

01Narrative

Morchella angusticeps is a species of fungus in the family Morchellaceae native to eastern North America. Described by Charles Horton Peck in 1879, the name M. angusticeps was clarified in 2012 prior to which this species may have been referred to as either M. angusticeps or M. elata. M. angusticeps is one of the black morels, and is found in eastern North America, where it occurs in association with various hardwoods in the spring. A similar, although smaller, black morel occurs in northeastern North America, M. septentrionalis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition21 compounds

Compounds documented for Morchella angusticeps across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Aminoacids21

Documented compounds21 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Valine	present	LOTUS
(-)-Cystine	present	LOTUS
(2R)-2-azaniumyl-3-phenylpropanoate	present	LOTUS
(2S)-2-(phenylazaniumyl)propanoate	present	LOTUS
(2S)-2-ammonio-3-(1H-imidazol-4-yl)propanoate	present	LOTUS
(2S)-2-ammonio-3-(4-hydroxyphenyl)propanoate	present	LOTUS
(2S,3S)-2-ammonio-3-methylpentanoate	present	LOTUS
Arginine	present	LOTUS
d,l-Serine	present	LOTUS
D-Alanine	present	LOTUS

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Morchella angusticeps has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes2

GenBank sequences10

eDNA detections13

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOR625698.1 ↗568 bpCzech Republic · 2019

ACGT

CTAACCCTCTGCGTACCTGTCCCTTCTTGCTTCCCCCGGCATCTCTCGTCGGGGGGAGGGAACAACCAAAACTCTTTGTGAATCAAACAG …

Morchella angusticeps voucher F470 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Morchella angusticeps carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size56 790 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Morchella angusticeps0.06 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type890 records

Wild obs. + sensor776

Museum / vouchered114

Range

Area of Occupancy AOO2 968 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 319≤1 km 99≤10 km 56>10 km 221

695 georeferenced · 81 without coordinates

Open the mapobservation + sensor776

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 52≤1 km 4≤10 km 23>10 km 7

86 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence114

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ann Arbor, US	24
Mexico City, MX	22
Tlalnepantla, MX	9
Université de Montréal Biodiversity Centrelocation not on record	8
Centro de Investigaciones Biológicas, Universidad Autónoma del Estado de Moreloslocation not on record	8
Chicago, US	7
Durango, MX	5
Toronto, CA	5
Mexico City, MX	4
WTUlocation not on record	3
Bronx, US	2
Helsinki, FI	2
Mexico City, MX	2
Cornell University, Plant Pathology Herbariumlocation not on record	1
Catholic University of Pekinglocation not on record	1
JA-CAGPDS-CAMlocation not on record	1
Görlitz, DE	1
Nagatoro-machi, Chichibu-gun, JP	1
Acadia Universitylocation not on record	1
Ciudad de México, MX	1
St. Paul, US	1
Copenhagen, DK	1
Tartu, EE	1
Canadian Department of Agriculturelocation not on record	1

24 institutions · 112 of 114 vouchered records shown · 1 without an institution code

09Environmental DNA13 detections

Where the DNA of Morchella angusticeps was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys2

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map3 countries0

Mostly Tulip Poplar, Ash and Maple

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C -3.10–15.5

Seasonal swing summer↔winter24.4 °C

Max temp (day)19.6 °C 2.10–21.5

Min temp (night)9.00 °C -7.80–9.40

Precipitation34.7 mm/mo 32.2–88.4

Air humidity56.8 % 52.1–57.5

Moisture balance-19.7 mm/mo -78.5–-3.80

Vapour deficit712 Pa 267–850

Wind speed4.10 m/s 3.10–4.70

Cloud cover46.9 % 29.8–59.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)