Montagnea arenaria

(DC.) Zeller · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Agaricaceae/Montagnea

At a glance

Occurrence records1 910

Data sources9

Biological traits0

DNA specimens19

eDNA detections345

Sources9 archives

Databases and archives Montagnea arenaria's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 910 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI345 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 910 records

Environmental DNA5 datasets · 2 countries345 detections

DNA & barcodingBOLD · NCBI19 specimens

01Narrative

Montagnea arenaria is a species of secotioid fungus in the family Agaricaceae. Originally named Agaricus arenarius by Augustin Pyramus de Candolle in 1815, it was transferred to the genus Montagnea by Sanford Myron Zeller in 1943. The species is characterized by a cap that has an apical disc, radial gills, a hymenophore, and spores with a prominent germ pore. It is inedible.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Montagnea arenaria has left across the world's sequence archives.

At a glance

DNA specimens19

Marker genes4

GenBank sequences10

eDNA detections345

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPP764796.1 ↗350 bpIraq

ACGT

ATTTGGGCCTTAGTGCCTATAAAACAAAATACAACCTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGA …

Montagnea arenaria strain Ra.Ah.3.IRAQ internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS128SEF1-alpha

fungal barcodemarker

08Occurrence & distribution

Record type1 910 records

Wild obs. + sensor1 611

Museum / vouchered297

Other2

Origin

Native27

Range

Area of Occupancy AOO5 676 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 835≤1 km 153≤10 km 94>10 km 127

1 209 georeferenced · 402 without coordinates

Open the mapobservation + sensor1 611

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 67≤1 km 17≤10 km 61>10 km 16

161 georeferenced · 136 without coordinates

Open the institutions mapphysical evidence297

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Centro de Estudios Superiores del Estado de Sonoralocation not on record	43
Museo Entomologico de Leonlocation not on record	40
Bronx, US	38
Blacksburg, US	16
Tartu, EE	15
Ann Arbor, US	10
Bernard Price Institute for Palaeontological Researchlocation not on record	8
Denver, US	7
California State University, East Baylocation not on record	7
Kensington, AU	6
WTUlocation not on record	6
University of Tennessee at Chattanoogalocation not on record	5
BDBClocation not on record	5
MAlocation not on record	4
Champaign, US	4
Adelaide, AU	4
Helsinki, FI	2
Copenhagen, DK	2
Santa Cruz, US	2
Philadelphia, US	2
Caldwell, US	2
DPIlocation not on record	2
WU-MYClocation not on record	2
Zapopan, MX	2
Toronto, CA	2
Vancouver, CA	2
TENN-Flocation not on record	1
ILLSlocation not on record	1
Long Beach, US	1
Görlitz, DE	1
Chicago, US	1
Catholic University of Pekinglocation not on record	1
BRNUlocation not on record	1
Gijón, ES	1
Boise, US	1

35 institutions · 247 of 297 vouchered records shown · 50 without an institution code

09Environmental DNA345 detections

Where the DNA of Montagnea arenaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found345

Studies independent surveys5

Countries2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 345 detections have coordinates

Open the map2 countries0

GrasslandShrublandDesert

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH6.40 4.00–9.50

Conductivity86.0 µS/cm 10.0–88,800

Organic carbon0.53 % 0.07–10.8

Water content3.65 % 0.362–51.5

Nitrate-N3.00 mg/kg 1.00–33.0

Phosphorus10.0 mg/kg 2.00–111

Clay12.1 % 1.08–67.0

Sand82.0 % 0–96.1

Depth0 m 0–0.9

SoilTenosolsSodosolRudosolKandosolDermosolChromosols

118 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.5 °C 10.7–25.1

Seasonal swing summer↔winter14.5 °C

Max temp (day)25.6 °C 15.5–32.9

Min temp (night)14.7 °C 6.20–17.2

Precipitation22.4 mm/mo 11.6–100

Air humidity50.4 % 41.1–65.1

Moisture balance-113 mm/mo -182–-22.1

Vapour deficit1,133 Pa 450–1,749

Wind speed3.70 m/s 2.50–4.80

Cloud cover13.6 % 8.30–36.8

CHELSA 1981–2010, ~9 km grid, at location & month of 338 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Montagnea arenaria

At a glance

Sources9 archives

At a glance

Record type1 910 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions21 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type1 910 records