Mononychus vulpeculus

(J.C.Fabricius, 1802) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Curculionidae/Mononychus

At a glance

Occurrence records491

Data sources5

Biological traits0

DNA specimens17

eDNA detections17

Sources5 archives

Databases and archives Mononychus vulpeculus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility491 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF491 records

Environmental DNA1 datasets · 1 countries17 detections

DNA & barcodingBOLD17 specimens

01Narrative

Mononychus vulpeculus, the iris weevil, is a species of minute seed weevil in the beetle family Curculionidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mononychus vulpeculus has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections17

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

337Amostly conserved

488Gmostly conserved

619Amostly conserved

AACATTATATTTTATTTTCGGAAGATGATCTGGCATAGTAGGTACTTCATTAAGAATACTCATTCGAACAGAGCTAGGAAACCCAGGCAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.10%

Haplotypes4

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Trachyphloeus alternanssame family17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type491 records

Wild obs. + sensor322

Museum / vouchered169

Range

Area of Occupancy AOO1 216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 164≤1 km 63≤10 km 10>10 km 29

266 georeferenced · 56 without coordinates

Open the mapobservation + sensor322

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy2% within 1 km

≤1 km 1≤10 km 64

65 georeferenced · 104 without coordinates

Open the institutions mapphysical evidence169

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Albany, US	68
University of Alabamalocation not on record	41
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	23
Lexington, US	8
University Park, US	8
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
University of Guelphlocation not on record	2
CUlocation not on record	1
Natural History Museum of Utahlocation not on record	1
UDlocation not on record	1
ASUlocation not on record	1
US	1

12 institutions · 161 of 169 vouchered records shown · 8 without an institution code

09Environmental DNA17 detections

Where the DNA of Mononychus vulpeculus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map1 country0

Temperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 13.2–19.5

Seasonal swing summer↔winter28.8 °C

Max temp (day)18.7 °C 16.4–24.5

Min temp (night)13.0 °C 7.80–15.1

Precipitation89.8 mm/mo 65.2–91.6

Air humidity59.5 % 56.5–62.2

Moisture balance-48.1 mm/mo -64.2–-26.2

Vapour deficit665 Pa 617–926

Wind speed2.20 m/s 2.00–2.80

Cloud cover42.7 % 41.0–47.6

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)