Monilochaetes infuscans

Harter · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Chaetosphaeriales/Australiascaceae/Monilochaetes

At a glance

Occurrence records29

Data sources6

Biological traits0

DNA specimens2

eDNA detections5

Sources6 archives

Databases and archives Monilochaetes infuscans's data was compiled from.

GBIFGlobal Biodiversity Information Facility29 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF29 records

Environmental DNA3 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Monilochaetes infuscans has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences4

eDNA detections5

The DNA barcodea real sequence read deposited for this species

ITSGU180626.1 ↗500 bp

ACGT

CATTACTGAGTTTACGCTCATAACCCTTTGTGAACATACCTACAATCGTTGCTTCGGCGGTGCGGGCCCCCAGCGGCCCCTCCAGGCCCC …

Monilochaetes infuscans strain CBS 869.96 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

08Occurrence & distribution

Record type29 records

Museum / vouchered25

Cultivated / captive4

Range

Area of Occupancy AOO84 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4>10 km 3

7 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence25

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	11
Auckland, NZ	7
Bernard Price Institute for Palaeontological Researchlocation not on record	3
ILLSlocation not on record	3
Catholic University of Pekinglocation not on record	1

5 institutions · 25 of 25 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Monilochaetes infuscans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys3

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)