Moniliophthora roreri

(Cif.) H.C.Evans, Stalpers, Samson & Benny · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Marasmiaceae/Moniliophthora

At a glance

Occurrence records538

Data sources9

Biological traits0

DNA specimens70

eDNA detections461

Sources9 archives

Databases and archives Moniliophthora roreri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility538 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI461 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics70 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF538 records

Environmental DNA3 datasets · 8 countries461 detections

DNA & barcodingBOLD · NCBI70 specimens

Genome at a glanceGoaT · NCBI55 Mbp

01Narrative

Moniliophthora roreri is a basidiomycete fungus that causes frosty pod rot disease, one of the most serious problems for cacao (Theobroma cacao— the source of chocolate) production in Latin America. This disease and together with witches’ broom disease (caused by M. perniciosa) and black pod rot (caused by Phytophthora sp.) constitute the cacao disease trilogy. It causes serious losses in southwestern parts of South America; spores are dry and powdery and are spread easily by water movement, wind, or movement of pods; disease spread is highest during periods of high rainfall.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding70 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Moniliophthora roreri has left across the world's sequence archives.

At a glance

DNA specimens70

Marker genes4

GenBank sequences10

eDNA detections461

Countries8

The DNA barcodea real sequence read deposited for this species

ITSPV577392.1 ↗598 bpBrazil · 2023

ACGT

AAGGAGGTTTTGAGCTGGCTCTTCTTAGGGGGGCATGTGCTCGCCGACTTTCAATCTTCATCCACCTGTGAACCTTTTGTAGTGGATTCT …

Moniliophthora roreri strain GEPQ101_H_CM internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1★ITS2

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Moniliophthora roreri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size54 840 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Moniliophthora roreri0.05 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness94.5% BUSCO

08Occurrence & distribution

Record type538 records

Wild obs. + sensor22

Museum / vouchered494

Cultivated / captive22

Range

Area of Occupancy AOO1 092 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 19 without coordinates

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 493 without coordinates

Open the institutions mapphysical evidence494

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 22 records without

Open the mapnot free-living22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
UAclocation not on record	1

1 institutions · 1 of 494 vouchered records shown · 471 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA461 detections

Where the DNA of Moniliophthora roreri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found461

Studies independent surveys3

Countries8

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 461 detections have coordinates

Open the map8 countries0

Neotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature18.0 °C 7.00–40.0

pH5.80 3.30–9.40

Conductivity44.0 µS/cm 6.00–115,200

Organic carbon1.45 % 0.004–5.84

Water content9.53 % 0.365–84.0

Nitrate-N4.00 mg/kg 0.277–160

Phosphorus8.00 mg/kg 2.00–590

Clay12.5 % 0.809–70.0

Sand74.3 % 2.00–98.1

Depth0 m 0–1.02

MarineSoilDermosolKandosolRudosolTenosolsChromosolsLatLon out of range

381 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 9.10–24.5

Seasonal swing summer↔winter11.6 °C

Max temp (day)24.4 °C 12.9–30.2

Min temp (night)12.8 °C 5.50–19.8

Precipitation36.4 mm/mo 6.60–113

Air humidity56.1 % 45.4–64.2

Moisture balance-94.1 mm/mo -142–47.8

Vapour deficit944 Pa 425–1,534

Wind speed3.40 m/s 2.10–4.80

Cloud cover20.9 % 9.10–38.5

CHELSA 1981–2010, ~9 km grid, at location & month of 413 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)