Moniliophthora perniciosa

(Stahel) Aime & Phillips-Mora · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Marasmiaceae/Moniliophthora

At a glance

Occurrence records589

Data sources9

Biological traits0

DNA specimens56

eDNA detections542

Sources9 archives

Databases and archives Moniliophthora perniciosa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility589 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI542 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics56 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF589 records

Environmental DNA3 datasets · 4 countries542 detections

DNA & barcodingBOLD · NCBI56 specimens

Genome at a glanceNCBI30 Mbp

01Narrative

Moniliophthora perniciosa (previously Crinipellis perniciosa) is a fungus that causes "witches' broom disease" (WBD) of the cocoa tree T. cacao. This pathogen is currently limited to South America, Panama and the Caribbean, and is perhaps one of the best-known cocoa diseases, thought to have co-evolved with cocoa in its centre of origin (first recorded in the Brazilian Amazon in 1785). This fungus is hemibiotroph, with two characteristic phases: biotrophic (expanding and infecting, on living tissue) and saprotrophic (producing basidiospores, on necrotic tissue). The biotrophic stage, and what triggers its switch to a saprotrophic stage, are still not understood.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding56 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Moniliophthora perniciosa has left across the world's sequence archives.

At a glance

DNA specimens56

Marker genes3

GenBank sequences10

eDNA detections542

Countries6

The DNA barcodea real sequence read deposited for this species

ITSPP267435.1 ↗712 bpPeru · 2021

ACGT

GTAGGTGAACCTGCGGAAGGATCATTATTGAAAACATTGTAAAGGAGGTTGAGCTGGCTCTTGTAGGGCATGTGCTCGCCGACTTTCAAT …

Moniliophthora perniciosa isolate MEB37_ITS_MP small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1

animal barcodefungal barcode

06Genome at a glanceNCBI

The complete instruction manual Moniliophthora perniciosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size30 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Moniliophthora perniciosa0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type589 records

Wild obs. + sensor8

Museum / vouchered581

Range

Area of Occupancy AOO1 344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 6 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 581 records without

Open the institutions mapphysical evidence581

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
UFESlocation not on record	1
Personal Herbarium of Alan Francklocation not on record	1
TENN-Flocation not on record	1

3 institutions · 3 of 581 vouchered records shown · 576 without an institution code

09Environmental DNA542 detections

Where the DNA of Moniliophthora perniciosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found542

Studies independent surveys3

Countries4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 542 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature20.0 °C 7.00–28.0

pH6.00 3.30–9.30

Conductivity45.6 µS/cm 10.0–164,500

Organic carbon1.35 % 0.06–5.84

Water content8.64 % 0.305–79.2

Nitrate-N3.00 mg/kg 0.5–209

Phosphorus6.00 mg/kg 2.00–396

Clay12.2 % 0.98–67.0

Sand79.0 % 1.00–98.1

Depth0 m 0–1.02

SoilDermosolTenosolsSodosolChromosolsOrganosolKandosol

483 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 11.5–25.2

Seasonal swing summer↔winter12.0 °C

Max temp (day)20.9 °C 15.5–29.3

Min temp (night)11.2 °C 7.20–19.5

Precipitation60.3 mm/mo 7.00–131

Air humidity57.4 % 45.6–61.5

Moisture balance-45.3 mm/mo -134–42.3

Vapour deficit787 Pa 517–1,538

Wind speed3.20 m/s 2.20–4.70

Cloud cover20.0 % 7.60–40.0

CHELSA 1981–2010, ~9 km grid, at location & month of 490 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)