Monilinia fructigena

(Pers.) Honey · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Helotiales/Sclerotiniaceae/Monilinia

At a glance

Occurrence records1 083

Data sources12

Biological traits0

DNA specimens39

eDNA detections41

Sources12 archives

Databases and archives Monilinia fructigena's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 083 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS23 compounds

Occurrence & distributionGBIF1 083 records

Environmental DNA2 datasets · 6 countries41 detections

DNA & barcodingBOLD · NCBI39 specimens

Genome at a glanceGoaT · NCBI≈43 Mbp

01Narrative

Monilinia fructigena is a plant pathogen in the fungus kingdom causing a fruit rot of apples, pears, plums, peaches and cherries.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition23 compounds

Compounds documented for Monilinia fructigena across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Anthraquinones and anthrones15

Ergostane steroids2

Stigmastane steroids1

Friedelane triterpenoids1

Lanostane, Tirucallane and Euphane triterpenoids1

Documented compounds23 total

Tissue Source Quantified only

Compound	Amount	Source
(3S,4S,5R,10S,13R,14R,17R)-4,10,13,14-tetramethyl-17-[(2R)-6-methyl-5-methylideneheptan-2-yl]-1,2,3,4,5,6,7,11,12,15,16,17-dodecahydrocyclopenta[a]phenanthren-3-ol	present	LOTUS
(3S,9R,10R,13R,14S,17R)-17-[(Z,2S,5R)-5,6-dimethylhept-3-en-2-yl]-10,13-dimethyl-2,3,4,9,11,12,14,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS
1,3,5-Trihydroxy-2-(Methoxymethyl)Anthracene-9,10-Dione	present	NPASS
1,3,5-Trihydroxy-9,10-dioxoanthracene-2-carbaldehyde	present	NPASS
1-Hydroxy-2-(hydroxymethyl)-9,10-anthracenedione	present	NPASS
2,5-Dihydroxy-1-methoxy-anthraquinone	present	NPASS
2-(Ethoxymethyl)-1,3,5-trihydroxyanthracene-9,10-dione	present	NPASS
24-Methylene-24-dihydrolanosterol	present	LOTUS
3,5-Dihydroxy-1-methoxy-9,10-dioxoanthracene-2-carbaldehyde	present	NPASS
3,5-Dihydroxy-2-(hydroxymethyl)-1-methoxyanthracene-9,10-dione	present	NPASS

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Monilinia fructigena has left across the world's sequence archives.

At a glance

DNA specimens39

Marker genes2

GenBank sequences10

eDNA detections41

Countries8

The DNA barcodea real sequence read deposited for this species

ITSPP321341.1 ↗318 bpTurkey · 2022

ACGT

CGTCTGAGTACTATACAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAA …

Monilinia fructigena isolate M3 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Monilinia fructigena carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈43 125 165 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Monilinia fructigena0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness97.2% BUSCO

08Occurrence & distribution

Record type1 083 records

Wild obs. + sensor899

Museum / vouchered162

Other22

Range

Area of Occupancy AOO3 264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 523≤1 km 102≤10 km 185>10 km 7

817 georeferenced · 82 without coordinates

Open the mapobservation + sensor899

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 8≤1 km 39≤10 km 34>10 km 8

89 georeferenced · 73 without coordinates

Open the institutions mapphysical evidence162

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	30
Academy of Sciences of the Republic of Uzbekistanlocation not on record	30
Tartu, EE	21
Bernard Price Institute for Palaeontological Researchlocation not on record	13
Catholic University of Pekinglocation not on record	6
Helsinki, FI	6
LDlocation not on record	5
Museo Entomologico de Leonlocation not on record	4
Karlsruhe, DE	4
Uppsala, SE	3
TROMlocation not on record	2
Philadelphia, US	2
Institute of Botany of the Academy of Sciences of the Republic of Uzbekistanlocation not on record	2
Görlitz, DE	1
Mlocation not on record	1
Stockholm, SE	1
Gijón, ES	1
Norwegian Institute of Bioeconomy Researchlocation not on record	1
Copenhagen, DK	1
WU-MYClocation not on record	1

20 institutions · 135 of 162 vouchered records shown · 16 without an institution code

09Environmental DNA41 detections

Where the DNA of Monilinia fructigena was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found41

Studies independent surveys2

Countries6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 41 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 7.90–15.3

Seasonal swing summer↔winter21.1 °C

Max temp (day)20.1 °C 10.0–20.1

Min temp (night)9.00 °C 3.90–10.5

Precipitation33.4 mm/mo 33.4–159

Air humidity52.9 % 52.9–63.2

Moisture balance-61.7 mm/mo -61.7–99.2

Vapour deficit953 Pa 436–953

Wind speed2.00 m/s 2.00–4.80

Cloud cover38.3 % 38.3–46.3

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Monilinia fructigena

At a glance

Sources12 archives

Compound class profile5 classes

Documented compounds23 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 083 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 083 records