Monascus purpureus

Went · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Monascaceae/Monascus

At a glance

Occurrence records15

Data sources12

Biological traits0

DNA specimens37

eDNA detections40

Sources12 archives

Databases and archives Monascus purpureus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 records↗

OBISOcean Biodiversity Information System4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS225 compounds

Occurrence & distributionGBIF · OBIS15 records

Environmental DNA4 datasets · 3 countries40 detections

DNA & barcodingBOLD · NCBI37 specimens

Genome at a glanceGoaT · NCBI23 Mbp

01Narrative

Monascus purpureus est une espèce de moisissure d'un rouge violacé. Elle est également connue sous les noms chinois simplifié : 红曲菌 ; chinois traditionnel : 红麴菌 ; pinyin : Hong Qu juin, sous le nom de moisissure du riz ang-khak, et sous les noms anglais : maize silage mold, corn silage mold, rice kernel discoloration.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition225 compounds

Compounds documented for Monascus purpureus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Azaphilones45

Unsaturated fatty acids41

Monacolins and Monacolin derivatives16

Simple coumarins9

Branched fatty acids9

Documented compounds225 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-gamma-Tocopherol	present	NPASS
(+)-Ursolic Acid	present	NPASS
(14S)-14-Methylhexadecanoic acid	present	LOTUS
(16S)-16-methyloctadecanoic acid	present	LOTUS
(1aR,4aR,6R,7aR,7bS)-1,1,6-trimethyl-4-methylidene-1a,2,3,4a,5,7,7a,7b-octahydrocyclopropa[e]azulen-6-ol	present	LOTUS
(1R,3aS,5aR,5bR,7aR,9R,11aR,11bR,13aS,13bR)-9-hydroxy-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a-carboxylic acid	present	LOTUS
(1R,3aS,5aR,5bR,7aS,9R,11aR,11bR,13aR,13bR)-9-acetyloxy-5a,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a-carboxylic acid	present	LOTUS
(1S,2S,4aR,6S,8-S,8aS,3'S,5'R,2''S)-methyl 1,2,4a,5,6,7,8,8a-octahydro-3',5'-dihydroxy-2,6-dimethyl-8-[(2-methyl-1-oxobutyl)oxy]-1-naphthaleneheptanoate	present	LOTUS
(1S,4AS,7S,7aS)-7-hydroxy-7-methyl-1-(((2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(((4-hydroxybenzoyl)oxy)methyl)tetrahydro-2H-pyran-2-yl)oxy)-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carboxylic acid	present	NPASS
(2E)-2-[(4aS,5R,7R,8R,8aS)-5-acetyloxy-4,4,7,8a-tetramethylspiro[2,3,4a,5,6,7-hexahydro-1H-naphthalene-8,5'-oxolane]-2'-ylidene]acetic acid	present	NPASS

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Monascus purpureus has left across the world's sequence archives.

At a glance

DNA specimens37

Marker genes5

GenBank sequences10

eDNA detections40

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPZ100133.1 ↗446 bpMexico · 2020

ACGT

ACCCAACCTCCCACCCGTGATTATTGTACCTCCTGTTGCTTCGGCGCGGCCCCCTGGGGCCCGCCGGAGACATCTTCTCGAACGCTGTCT …

Monascus purpureus strain CIMA-F-131 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1★ITS25-8S

animal barcodefungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Monascus purpureus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size23 440 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Monascus purpureus0.02 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness95% BUSCO

08Occurrence & distribution

Record type15 records

Wild obs. + sensor2

Museum / vouchered11

Cultivated / captive2

Range

Area of Occupancy AOO28 km²

Depth

0–200 m sunlit4

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 3 m · max 4 m · 4 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence11

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
ARMS-MBONlocation not on record	4
UAclocation not on record	1
University of Athens, Hellenic Collection of Pathogenic Fungilocation not on record	1
DPIlocation not on record	1

4 institutions · 7 of 11 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA40 detections

Where the DNA of Monascus purpureus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found40

Studies independent surveys4

Countries3

Verifiable raw sequence linked6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 40 detections have coordinates

Open the map3 countries0

Marine Protected Area; protected; 9.2 - Subt…Marina/Harbour; semi-industrial; 9.6 - Subti…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.7 °C 11.7–24.0

Seasonal swing summer↔winter15.9 °C

Max temp (day)21.8 °C 13.4–28.2

Min temp (night)14.6 °C 7.60–19.5

Precipitation62.9 mm/mo 15.6–211

Air humidity58.5 % 56.2–63.3

Moisture balance-53.4 mm/mo -123–108

Vapour deficit891 Pa 542–1,298

Wind speed3.40 m/s 2.00–3.80

Cloud cover40.6 % 17.4–63.3

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)