Mompha locupletella

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Momphidae/Mompha

At a glance

Occurrence records1 066

Data sources9

Biological traits2

DNA specimens31

eDNA detections66

Sources9 archives

Databases and archives Mompha locupletella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 066 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI66 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 066 records

Environmental DNA3 datasets · 10 countries66 detections

DNA & barcodingBOLD31 specimens

Genome at a glanceGoaT · NCBI≈510 Mbp

01Narrative

Mompha locupletella is a moth in the family Momphidae that can be found in the Palearctic including Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mompha locupletella has left across the world's sequence archives.

At a glance

DNA specimens31

BINs2

Marker genes1

eDNA detections66

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

1Tmostly conserved

50Tmostly conserved

74Tmostly conserved

85Amostly conserved

133Tmostly conserved

220Cmostly conserved

256Cmostly conserved

283Cmostly conserved

313Tmostly conserved

335Gmostly conserved

367Tmostly conserved

376Tmostly conserved

400Tmostly conserved

412Cmostly conserved

433Gmostly conserved

448Tmostly conserved

454Amostly conserved

517Cmostly conserved

529Tmostly conserved

533Tmostly conserved

542Cmostly conserved

574Cmostly conserved

578Tmostly conserved

653Cmostly conserved

TACATTATATTTTATTTTCGGAATTTGAGCAGGAATAATTGGTACTTCATTAAGATTACTAATTCGAGCAGAATTAGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes6

BINs2

Most divergent pair4.0%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mompha miscellasame genus7.8%Zanclognatha pedipilalissame order9.4%Eublemma iophaennasame order9.7%Chlorosterrha dichromasame order9.9%Mompha edithellasame genus10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Mompha locupletella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈509 779 239 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Mompha locupletella0.51 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.3% BUSCO

08Occurrence & distribution

Record type1 066 records

Wild obs. + sensor730

Museum / vouchered318

Other18

Range

Area of Occupancy AOO2 980 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 299≤1 km 167≤10 km 213>10 km 3

682 georeferenced · 48 without coordinates

Open the mapobservation + sensor730

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 165≤1 km 105≤10 km 13

283 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence318

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	75
Tartu, EE	27
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	24
DanishLepidopterologicalSocietylocation not on record	23
Provincia di Livornolocation not on record	15
SLU Artdatabankenlocation not on record	14
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	8
Rovaniemi, FI	6
RMZlocation not on record	5
European Distributed Institute of Taxonomy (EDIT)location not on record	4
Salzburg, AT	4
Stockholm, SE	3
Kuopio, FI	2
BioFokuslocation not on record	2
Uniwersytet Łódzkilocation not on record	2
Helsinki, FI	1
Metsähallituslocation not on record	1
DABUHlocation not on record	1
Research Collection of Kai Berggrenlocation not on record	1
Kushiro City Museumlocation not on record	1

20 institutions · 219 of 318 vouchered records shown · 99 without an institution code

09Environmental DNA66 detections

Where the DNA of Mompha locupletella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found66

Studies independent surveys3

Countries10

Verifiable raw sequence linked36

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 66 detections have coordinates

Open the map10 countries0

Bog edge in alpine birch forestForestFarmland, coast and birch habitatGarden, coast and birch habitatAlpine willow zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 10.5–16.2

Seasonal swing summer↔winter21.6 °C

Max temp (day)15.7 °C 13.0–19.5

Min temp (night)8.50 °C 5.30–12.9

Precipitation136 mm/mo 96.4–168

Air humidity62.1 % 59.5–64.8

Moisture balance43.3 mm/mo -5.10–85.0

Vapour deficit563 Pa 453–736

Wind speed2.60 m/s 2.10–5.00

Cloud cover52.5 % 37.2–62.3

CHELSA 1981–2010, ~9 km grid, at location & month of 66 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mompha locupletella

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 066 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 066 records