Mompha langiella

(Hübner, 1796) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Momphidae/Mompha

At a glance

Occurrence records4 483

Data sources7

Biological traits2

DNA specimens78

eDNA detections159

Sources7 archives

Databases and archives Mompha langiella's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 483 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI159 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics78 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 483 records

Environmental DNA4 datasets · 10 countries159 detections

DNA & barcodingBOLD78 specimens

01Narrative

Mompha langiella is a moth of the family Momphidae. It is found in most of Europe, except parts of the Balkan Peninsula and the Mediterranean islands.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding78 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mompha langiella has left across the world's sequence archives.

At a glance

DNA specimens78

BINs1

Marker genes1

eDNA detections159

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus56 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

ACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGTACATCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCAGGATCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.12%

Haplotypes3

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Parapheromia lichenariasame order9.9%Calamodes subscudulariasame order9.9%Didymoctenia exsuperatasame order10.2%Melanolophia atigradasame order10.4%Deileptenia ribeatasame order10.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 483 records

Wild obs. + sensor3 688

Museum / vouchered782

Cultivated / captive1

Other12

Origin

Native1

Introduced1

Range

Area of Occupancy AOO6 464 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 1 934≤1 km 879≤10 km 475>10 km 7

3 295 georeferenced · 393 without coordinates

Open the mapobservation + sensor3 688

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy98% within 1 km

≤100 m 496≤1 km 110≤10 km 10

616 georeferenced · 166 without coordinates

Open the institutions mapphysical evidence782

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	110
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	97
NHMOlocation not on record	83
SLU Artdatabankenlocation not on record	46
NTNU-VMlocation not on record	44
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	37
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	34
Tartu, EE	24
Washington, US	7
BioFokuslocation not on record	5
Salzburg, AT	3
Stockholm, SE	3
neflocation not on record	3
Bavarian State Collection of Zoologylocation not on record	2
South Kensington, GB	2
Trondheim, NO	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Cornell University Insect Collectionlocation not on record	1

18 institutions · 503 of 782 vouchered records shown · 279 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA159 detections

Where the DNA of Mompha langiella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found159

Studies independent surveys4

Countries10

Verifiable raw sequence linked80

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 159 detections have coordinates

Open the map10 countries0

Urban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.7 °C 5.80–15.3

Seasonal swing summer↔winter17.8 °C

Max temp (day)14.9 °C 8.20–19.2

Min temp (night)6.70 °C 0.5–12.0

Precipitation61.9 mm/mo 44.9–95.3

Air humidity60.5 % 57.9–63.8

Moisture balance0.8 mm/mo

Vapour deficit515 Pa 360–683

Wind speed3.20 m/s

Cloud cover48.2 % 38.5–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 157 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mompha langiella

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type4 483 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions6 of 18 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 483 records