Mompha eloisella

(Clemens, 1860) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Momphidae/Mompha

At a glance

Occurrence records1 078

Data sources7

Biological traits0

DNA specimens33

eDNA detections31

Sources7 archives

Databases and archives Mompha eloisella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 078 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 078 records

Environmental DNA1 datasets · 2 countries31 detections

DNA & barcodingBOLD33 specimens

01Narrative

Mompha eloisella, the red-streaked mompha, is a species of momphid moth in the family Momphidae. The MONA or Hodges number for Mompha eloisella is 1443.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mompha eloisella has left across the world's sequence archives.

At a glance

DNA specimens33

BINs1

Marker genes2

eDNA detections31

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

103Tmostly conserved

160Amostly conserved

205Tvariable

229Amostly conserved

268Amostly conserved

271Cmostly conserved

274Cmostly conserved

340Cmostly conserved

343Tmostly conserved

352Amostly conserved

373Tmostly conserved

433Gvariable

439Tmostly conserved

490Tmostly conserved

544Amostly conserved

619Avariable

628Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes16

BIN1

Most divergent pair2.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Kentrochrysalis consimilissame order8.5%Orthosia populetisame order8.7%Balbura fasciatasame order8.7%Scopula oppertasame order8.7%Ambulyx zhejiangensissame order8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type1 078 records

Wild obs. + sensor858

Museum / vouchered220

Range

Area of Occupancy AOO2 228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 500≤1 km 123≤10 km 30>10 km 67

720 georeferenced · 138 without coordinates

Open the mapobservation + sensor858

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 5≤1 km 13≤10 km 24>10 km 6

48 georeferenced · 172 without coordinates

Open the institutions mapphysical evidence220

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	135
Cornell University Insect Collectionlocation not on record	19
East Lansing, US	14
Washington, US	12
San Diego, US	10
Philadelphia, US	4
Denver, US	4
University of Alberta Museums (UAM)location not on record	4
CUlocation not on record	2
Colorado State Universitylocation not on record	2
US	2
New Haven, US	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Cambridge, US	1
Decorah, US	1
St. Paul, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
Essig Museum of Entomologylocation not on record	1
ASUlocation not on record	1

21 institutions · 218 of 220 vouchered records shown · 2 without an institution code

09Environmental DNA31 detections

Where the DNA of Mompha eloisella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map2 countries0

Temperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 17.6–25.0

Seasonal swing summer↔winter25.7 °C

Max temp (day)25.1 °C 22.1–30.2

Min temp (night)14.2 °C 12.5–20.6

Precipitation108 mm/mo 69.8–139

Air humidity57.7 % 55.1–60.0

Moisture balance-53.5 mm/mo -90.7–-3.00

Vapour deficit990 Pa 859–1,439

Wind speed3.90 m/s 1.70–5.80

Cloud cover38.2 % 27.6–46.7

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mompha eloisella

At a glance

Sources7 archives

At a glance

Record type1 078 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 078 records