Momotus aequatorialis

Gould, 1858 · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Coraciiformes/Momotidae/Momotus

At a glance

Occurrence records108 441

Data sources8

Biological traits29

DNA specimens3

eDNA detections0

Sources8 archives

Databases and archives Momotus aequatorialis's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility108 441 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources29 traits

Occurrence & distributionGBIF108 441 records

DNA & barcodingBOLD3 specimens

01Narrative

The Andean motmot or highland motmot (Momotus aequatorialis) is a colorful near-passerine bird found from northern Colombia to western Bolivia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAVONETEltonTraits

Size & morphology13

Beak depth14.1 mm

Beak length (culmen)45 mm

Beak length (nares)33.2 mm

Beak width11.2 mm

Body mass120 g

⚠ sources differ — AmnioteDB: 120 g · AVONET: 158 g · EltonTraits: 158 g

Body mass (female)102 g

Body mass (male)112 g

Hand-wing index17.4

Kipp's distance26.8 mm

Secondary length127 mm

Tail length282 mm

Tarsus length28.4 mm

Wing length155 mm

Life cycle & reproduction6

Egg mass12.05 g

Fledging age30.5 days

Incubation21 days

Litter size3.5

Litters per year1 /year

Max. longevity244 months

Diet & foraging6

Ground40 %

Invertebrate100 %

Midhigh40 %

Trophic levelcarnivore

Trophic nicheInvertivore

Understory20 %

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size97 380 km²

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Momotus aequatorialis has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P623 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.3%

Haplotypes1

BIN1

Where individuals differ — all 12 variable positions, in barcode order

199Gvariable

244Gvariable

247Gvariable

259Avariable

275Tvariable

284Gvariable

325Avariable

388Gvariable

412Tvariable

430Avariable

469Tvariable

529Cvariable

AGGAACCCTACTAGGAGATGACCAAATTTACAACGTAGTAGTCACTGCCCATGCTTTCGTTATAATTTTCTTTATAGTCATACCAATCAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Momotus momotasame genus5.1%Momotus mexicanussame genus5.8%Baryphthengus ruficapillussame family10.3%Baryphthengus martiisame family10.3%Poecile lugubrissame order13.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type108 441 records

Wild obs. + sensor108 364

Museum / vouchered77

Origin

Native58

Range

Area of Occupancy AOO20 272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 1 833≤1 km 742≤10 km 215>10 km 107

2 897 georeferenced · 105 467 without coordinates

Open the mapobservation + sensor108 364

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 1≤1 km 4≤10 km 7

12 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence77

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidad de Caldas (UCaldas)location not on record	22
Louisiana State University, Museum of Zoologylocation not on record	14
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	12
Universidad del Valle (UniValle)location not on record	8
Geneva, CH	6
Wuzhou, CN	4
Paris, FR	3
Universidad del Tolima (UT)location not on record	3
Instituto de Ciencias Naturales (ICN)location not on record	1
Universidad Icesi (ICESI)location not on record	1
München, DE	1
Universidad de Antioquia (UdeA)location not on record	1
Universidad Industrial de Santander (UIS)location not on record	1

13 institutions · 77 of 77 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Momotus aequatorialis

At a glance

Sources8 archives

Size & morphology13

Life cycle & reproduction6

Diet & foraging6

Habitat & environment4

At a glance

Record type108 441 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 13 geolocated

Record type108 441 records