Mola tecta

Nyegaard, Sawai, Gemmell, Gillum, Loneragan, Yamanoue & Stewart, 2017 · species

image placeholder — illustration coming later

Animalia/Chordata/Tetraodontiformes/Molidae/Mola

At a glance

Occurrence records129

Data sources7

Biological traits4

DNA specimens8

eDNA detections0

Sources7 archives

Databases and archives Mola tecta's data was compiled from.

WikipediaWikimedia Foundation12 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility112 records↗

OBISOcean Biodiversity Information System17 records↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS129 records

DNA & barcodingBOLD8 specimens

01Narrative

Mola tecta compared to Mola alexandrini Mola tecta, the hoodwinker sunfish, belongs to the family Molidae and genus Mola. It is closely related to the more widely known ocean sunfish (Mola mola). The Latin word "tecta" means hidden. The word "hidden" was adopted for the name because the fish has blended in among other species of sunfish for a long time and has only been discovered recently. Discovered on a beach near Christchurch, New Zealand, in 2015, it was the first new species of sunfish to be identified in 130 years. Mola tecta are mostly discovered in the temperate region of Southern Hemisphere in the water near Australia, New Zealand Southern Chile and Southern Africa. It was first described by Marianne Nyegaard, a marine scientist who studied ocean sunfish for her PhD.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length242 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic-oceanic

Other traits1

Vulnerability90

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mola tecta has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P669 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.22%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 4 variable positions, in barcode order

551Tmostly conserved

661Tmostly conserved

662Cmostly conserved

665Avariable

TTTATTTAGTATTCGGTGCATGAGCCGGGATAGTGGGGACGGCCTTAAGCCTACTCATTCGAGCGGAGCTAAGTCAACCTGGCGCTCTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mola molasame genus4.5%Masturus lanceolatussame family8.9%Ranzania laevissame family12.8%Sphoeroides spenglerisame order15.2%Lutjanus novemfasciatussame order16.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type129 records

Wild obs. + sensor76

Museum / vouchered53

Range

Area of Occupancy AOO296 km²

Depth

0–200 m sunlit8

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0 m · max 0 m · 8 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 30≤1 km 28≤10 km 5>10 km 3

66 georeferenced · 10 without coordinates

Open the mapobservation + sensor76

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 11≤1 km 2≤10 km 4>10 km 2

19 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	10
Auckland, NZ	9
Sydney, AU	7
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	2
CASlocation not on record	1
University of California San Diegolocation not on record	1

6 institutions · 30 of 53 vouchered records shown · 22 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)