Moesziomyces antarcticus

(Goto, Sugiy. & Iizuka) Q.M.Wang, Begerow, F.Y.Bai & Boekhout · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Ustilaginomycetes/Ustilaginales/Ustilaginaceae/Moesziomyces

At a glance

Occurrence records8

Data sources10

Biological traits0

DNA specimens0

eDNA detections10

Sources10 archives

Databases and archives Moesziomyces antarcticus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS32 compounds

Occurrence & distributionGBIF8 records

Environmental DNA5 datasets · 2 countries10 detections

DNA & barcodingNCBIsequences

Genome at a glanceGoaT · NCBI18 Mbp

01Narrative

Candida antarctica is a yeast species in the genus Candida. Candida antarctica is a source of important industrial enzymes. Immobilized Candida antarctica lipase can be used to catalyze the regioselective acylation of flavonoids or the direct acetylation with phenolic acids. This species contains a lipase enzyme that is able to cleave ester bonds in PET plastic.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition32 compounds

Compounds documented for Moesziomyces antarcticus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Aporphine alkaloids $ Isoquinoline alkaloids10

Isoquinoline alkaloids6

Aporphine alkaloids6

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids3

Hasubanan alkaloids $ Isoquinoline alkaloids3

Documented compounds32 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Berbamine	present	NPASS
(-)-Phanostenine	present	NPASS
(-)-Roemeroline	present	NPASS
(12S)-15,16-dimethoxy-11-methyl-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,14(19),15,17-hexaene	present	NPASS
(14aS,26aR)-2,3,13,14,14a,15,26,26a-Octahydro-22,30-dimethoxy-14-methyl-1H-4,6:16,19-dietheno-21,25-metheno-12H-[1,3]dioxolo[4,5-g]pyrido[2 inverted exclamation marka,3 inverted exclamation marka:17,18][1,10]dioxacycloeicosino[2,3,4-ij]isoquinoline	present	NPASS
(1S,10S)-3-hydroxy-6-[(1S,10S)-3-hydroxy-4,11,12-trimethoxy-17-methyl-13-oxo-17-azatetracyclo[8.4.3.01,10.02,7]heptadeca-2(7),3,5,11-tetraen-6-yl]-4,11,12-trimethoxy-17-methyl-17-azatetracyclo[8.4.3.01,10.02,7]heptadeca-2(7),3,5,11-tetraen-13-one	present	NPASS
(4aR,16aS)-3,4,4a,5,16a,17,18,19-Octahydro-9,21,22,26-tetramethoxy-4,17-dimethyl-2H-1,24:12,15-dietheno-6,10-metheno-16H-pyrido(2',3':17,18)(1,10)dioxacycloeicosino(2,3,4-ij)isoquinoline	present	NPASS
(5S)-11-methoxy-5-[[4-(2-methoxy-5-methylphenoxy)phenyl]methyl]-6,19-dimethyl-2,13-dioxa-6,19-diazapentacyclo[12.8.0.03,12.04,9.016,21]docosa-1(14),3,9,11,15,21-hexaen-20-one	present	NPASS
(6aS)-1,2-dimethoxy-5,6,6a,7-tetrahydro-4H-dibenzo[de,g]quinolin-10-ol	present	NPASS
(9S,12R)-15,16-dimethoxy-11-methyl-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,14(19),15,17-hexaen-9-ol	present	NPASS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Moesziomyces antarcticus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections10

Countries7

The DNA barcodea real sequence read deposited for this species

ITSPV111167.1 ↗680 bpIndian Ocean · 2024

ACGT

ATCATTTTCGATGAAAAACCTTTTTTCTTGAGGTGTGGCTCGCACCTGTCTAACTAAACTTGAGCTACCCTCTTTTAACACGGTTGCATC …

Moesziomyces antarcticus isolate NIOT124 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Moesziomyces antarcticus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size18 070 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Moesziomyces antarcticus0.02 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

Completeness98.3% BUSCO

08Occurrence & distribution

Record type8 records

Museum / vouchered8

Range

Area of Occupancy AOO24 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

09Environmental DNA10 detections

Where the DNA of Moesziomyces antarcticus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys5

Countries2

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 9.40–25.4

Seasonal swing summer↔winter13.2 °C

Max temp (day)19.7 °C 11.6–27.7

Min temp (night)13.6 °C 5.10–22.1

Precipitation274 mm/mo 218–330

Air humidity66.3 % 65.2–67.5

Moisture balance163 mm/mo 83.6–243

Vapour deficit802 Pa 503–1,102

Wind speed2.10 m/s 1.40–2.70

Cloud cover48.8 % 45.4–52.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)