Moenkhausia agnesae

Géry, 1965 · species

image placeholder — illustration coming later

Animalia/Chordata/Characiformes/Characidae/Moenkhausia

At a glance

Occurrence records13

Data sources6

Biological traits4

DNA specimens4

eDNA detections4

Sources6 archives

Databases and archives Moenkhausia agnesae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF13 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

Moenkhausia agnesae est une espèce de poissons d'eau douce de la famille des Characidés originaire d'Amérique du Sud au Pérou. Ce poisson est assez rarement disponible pour l'aquariophilie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length6.9 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Moenkhausia agnesae has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P505 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AGGTTTACAATGTTCTAGTAACTGCTCATGCTTTTGTAATAATCTTTTTTATAGTTATACCCGTAATAATCGGCGGTTTTGGTAACTGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Coelorinchus hoangisame order16.0%Poptella compressasame family16.1%Coelorinchus maurofasciatussame order16.2%Astyanax gitonsame order16.2%Astyanax hastatussame order16.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type13 records

Museum / vouchered13

Range

Area of Occupancy AOO40 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 13 records without

Open the institutions mapphysical evidence13

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Nebraskalocation not on record	3
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	3
Montgomery, US	1
SNSDlocation not on record	1
Stockholm, SE	1
PUC-RSlocation not on record	1

6 institutions · 10 of 13 vouchered records shown · 3 without an institution code

09Environmental DNA4 detections

Where the DNA of Moenkhausia agnesae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.0 °C 26.0–26.0

Seasonal swing summer↔winter1.30 °C

Max temp (day)29.5 °C

Min temp (night)23.6 °C

Precipitation284 mm/mo

Air humidity71.2 %

Moisture balance157 mm/mo

Vapour deficit962 Pa

Wind speed0.8 m/s

Cloud cover50.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)