Mniodes longifolia — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Mniodes

At a glance

Occurrence records20

Data sources5

Biological traits8

DNA specimens0

eDNA detections2

Sources5 archives

Databases and archives Mniodes longifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility20 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF20 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingNCBIsequences

01Narrative

Luciliocline longifolia là một loài thực vật có hoa trong họ Cúc. Loài này được M.O.Dillon & Sagást. mô tả khoa học đầu tiên năm 2003.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Elevation max4 500 m

Elevation min1 330 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mniodes longifolia has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSKM091400.1 ↗622 bp

ACGT

TCGAACCCTGCAAAGCAGAACGACTCGTGAACATGTAACTACAACTGGACAACATAAGGATTGAGCTCTTGTTTGATCCTTAGTTGCCTT …

Belloa longifolia voucher SI:Urtubey et al. 507 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS3

fungal barcode

08Occurrence & distribution

Record type20 records

Wild obs. + sensor20

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 9≤1 km 3

12 georeferenced · 8 without coordinates

Open the mapobservation + sensor20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA2 detections

Where the DNA of Mniodes longifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.