Mitrulinia ushuaiae

(Rehm) Spooner · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Helotiales/Sclerotiniaceae/Mitrulinia

At a glance

Occurrence records30

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Mitrulinia ushuaiae's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility30 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF30 records

DNA & barcodingNCBIsequences

01Narrative

Mitrulinia is a fungal genus of uncertain familial placement in the order Helotiales. Mitrulinia is a monotypic genus, containing the single species Mitrulinia ushuaiae. The genus was circumscribed in 1987 by mycologist Brian Spooner. Mitrulinia populations have been found separately in Argentina and on the South Island of New Zealand. Spores or hyphal fragments were also found present in snow on Livingston Island, Antarctica. Individuals found in New Zealand are thought to belong to a novel species rather than Mitrulinia ushuiae. It produces a stipitate-capitate ascocarp (a fruiting body) arising from a substratal or sclerotial stroma tissue.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mitrulinia ushuaiae has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKY462418.1 ↗476 bpArgentina

ACGT

GATCATTACAGTGTTCCTGCCCTCACGGGTAGAAACCCCACCCTTGTATACTCTATACTTGTTGCTTTAGCGGGCCGCAAGGCTTCGGCT …

Mitrulinia ushuaiae voucher MES-1097 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type30 records

Wild obs. + sensor19

Museum / vouchered11

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 3≤1 km 7≤10 km 1>10 km 1

12 georeferenced · 7 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	5
IMBIVlocation not on record	2
Fort Hayslocation not on record	2
Leicester, GB	1
FLASlocation not on record	1

5 institutions · 11 of 11 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)