Mischonyx squalidus

Bertkau, 1880 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Opiliones/Gonyleptidae/Mischonyx

At a glance

Occurrence records337

Data sources5

Biological traits0

DNA specimens6

eDNA detections3

Sources5 archives

Databases and archives Mischonyx squalidus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility337 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF337 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD6 specimens

01Narrative

Mischonyx cuspidatus is een hooiwagen uit de familie Gonyleptidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mischonyx squalidus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs2

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P570 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.63%

Haplotypes2

BINs2

Most divergent pair1.1%

Where individuals differ — all 6 variable positions, in barcode order

45Cvariable

57Cvariable

264Cvariable

291Cvariable

453Cvariable

499Cvariable

TCCTCTAGAGGAAATTTTATTACCAATGACCAAACCTTTAATGTCATAGTAACCTCCCATGCCTTTATTATAATTTTCTTTATAGTTATA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mischonyx spinifronssame genus7.8%Mischonyx processigerussame genus10.4%Mischonyx intermediussame genus13.2%Mischonyx clavifemursame genus13.9%Mischonyx insulanussame genus13.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type337 records

Wild obs. + sensor336

Museum / vouchered1

Range

Area of Occupancy AOO892 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 134≤1 km 62≤10 km 41>10 km 37

274 georeferenced · 62 without coordinates

Open the mapobservation + sensor336

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
PUC-RSlocation not on record	1

1 institutions · 1 of 1 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Mischonyx squalidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)