Mimulopsis solmsii

Schweinf. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Acanthaceae/Mimulopsis

At a glance

Occurrence records285

Data sources7

Biological traits12

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Mimulopsis solmsii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility285 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources12 traits

Occurrence & distributionGBIF285 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Mimulopsis solmsii is a flowering plant from the family Acanthaceae and is the type species for the genus Mimulopsis.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology3

Plant height5 m

Plant height max3.66 m

Plant height min0.8 m

Life cycle & reproduction2

Life formscrambling shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mimulopsis solmsii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSJX443786.1 ↗657 bp

ACGT

CCGTAGGTGAACCTGCGGAAGATCATTGTCGAAACCTGCACAGCAGACCGCGAACACGTGTGACAACTACACCGGGGCCGCGGTGCGTGG …

Mimulopsis solmsii internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

08Occurrence & distribution

Record type285 records

Wild obs. + sensor13

Museum / vouchered272

Range

Area of Occupancy AOO612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 4≤10 km 4

8 georeferenced · 5 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤1 km 1≤10 km 5

6 georeferenced · 266 without coordinates

Open the institutions mapphysical evidence272

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	62
MeiseBGlocation not on record	60
Saint Louis, US	38
Adam Mickiewicz University in Poznańlocation not on record	14
Yaoundé, CM	11
WAGlocation not on record	4
Instituto de Investigação Científica Tropicallocation not on record	4
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	2
University of Stellenboschlocation not on record	2
Chongqing Museumlocation not on record	2
Herbier National du Gabonlocation not on record	2
Bloomington, US	2
TAFORI-LSRClocation not on record	2
Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record	1
BRLUlocation not on record	1
DSMlocation not on record	1
MAlocation not on record	1
LGlocation not on record	1
Claremont, US	1
Moscow State Universitylocation not on record	1
Llocation not on record	1
EAlocation not on record	1
Arusha, TZ	1
University of Oxfordlocation not on record	1
Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record	1

25 institutions · 217 of 272 vouchered records shown · 55 without an institution code

09Environmental DNA2 detections

Where the DNA of Mimulopsis solmsii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)