Mimosa pudica
speciesAt a glance
Occurrence records26 116
Data sources16
Biological traits58
DNA specimens36
eDNA detections19
Sources16 archives
Databases and archives Mimosa pudica's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility26 068 records↗
OBISOcean Biodiversity Information System48 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics36 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources58 traits
Chemical compositionLOTUS · NPASS48 compounds
Occurrence & distributionGBIF · OBIS26 116 records
Environmental DNA1 datasets · 6 countries19 detections
DNA & barcodingBOLD · NCBI36 specimens
Genome at a glanceCCDB · GoaT · NCBI587 Mbp
01Narrative
La Sensitive ou le Mimosa pudique est une espèce de plantes à fleurs, de la famille des Fabacées. C'est une plante rampante de 10 à 40 cm de haut, originaire d'Amérique centrale et largement naturalisée à travers le monde. Elle est connue aux Antilles françaises sous les noms de Manzelle Marie, Marie-honte, herbe mamzelle ou honteuse femelle, à l'île Maurice et La Réunion sous le nom de sensitive ou trompe la mort, en Nouvelle-Calédonie sous le nom de sensitive. Cette espèce dite « sensitive » est souvent utilisée en laboratoire comme espèce modèle pour l'étude des mécanismes de perception chez les plantes ; tout comme le sainfoin oscillant, elle l'a notamment été au début du XXe siècle par Jagadish Chandra Bose.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology26
Fruit length15.5 mm
Fruit length max20 mm
Fruit length min10 mm
Fruit width4.25 mm
Fruit width max5 mm
Fruit width min3 mm
Leaf length13.5 mm
Leaf length max55 mm
Leaf length min1 mm
Leaf size27 mm²
Leaf width2.25 mm
Leaf width max3 mm
Leaf width min1 mm
Petiole length4 cm
Plant height0.45 m
⚠ sources differ — GIFT: 0.45 m · AusTraits: 1.1 m · TRY: 20 m
Plant height max1.5 m
Plant height min0 m
Seed length3 mm
Seed length max3.5 mm
Seed length min2.5 mm
Seed mass5.25 mg
⚠ sources differ — TRY: 5.25 mg · AusTraits: 1.7 mg · GIFT: 5.35 mg
Seed mass max5.96 mg
Seed mass min4.62 mg
Seed volume5.1 mm³
Seed volume max5.1 mm³
Seed volume min5.1 mm³
Life cycle & reproduction10
Dehiscencedehiscent
Dispersal typeanimal
Flower colourred
Flowering startDec
Flowering timeyyyyyyynnnny
Life formannual, perennial or subshrub
Life spanperennial
Pollination syndromebee
Raunkiær life formtherophyte
Resprouting capacityresprouts
Diet & foraging1
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climatewet tropical
Climberself-supporting
Elevation max1 780 m
Elevation mean1 750 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typelegume
Growth formherb
Habitat GIFTforest
Leaf compoundnesscompound
Leaf shapeoblong
Mycorrhiza typearbuscular
Succulenceno
Woodinessvariable
⚠ sources differ — TRY: non-woody/woody · AusTraits: herbaceous woody · GIFT: non-woody
Physiology & chemistry4
Leaf n20.2 mg/g
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)30.49 mm²/mg
Other traits1
Shoot orientationprostrate
03Chemical composition48 compounds
Compounds documented for Mimosa pudica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols6
Flavones6
Fatty alcohols4
Aminoacids3
Simple coumarins2
Documented compounds48 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Alpha-Tocopheryl Succinate | present | NPASS | |
| (2R,3S,4S,10Bs)-3,4,8,10-Tetrahydroxy-2-(Hydroxymethyl)-9-Methoxy-3,4,4A,10B-Tetrahydro-2H-Pyrano[3,2-C]Isochromen-6-One | present | NPASS | |
| (2S)-2-azaniumyl-3-(3-hydroxy-4-oxopyridin-1(4H)-yl)propanoate | present | LOTUS | |
| (2S,3S,4S,5R,6S)-6-(4-carboxy-2,6-dihydroxyphenoxy)-3,4,5-trihydroxyoxane-2-carboxylic acid | present | LOTUS | |
| 1-[(1S,2R)-1-amino-2-[[(1R,2S)-2-amino-1-hydroxy-2-(4-oxo-1-pyridinyl)ethyl]-hydroxyamino]-2-hydroxyethyl]pyridin-4-one | present | LOTUS | |
| 2,4-Bis(1-Phenylethyl)Phenol | present | NPASS | |
| 2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-((2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl)oxychromen-4-one | present | LOTUS | |
| 2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-6-[(2R,3S,5R,6S)-5-hydroxy-6-methyl-4-oxo-3-[(2S,3S,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]chromen-4-one | present | LOTUS | |
| 2-Aminothiophenol | present | LOTUS | |
| 3,5-dihydroxy-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(sulfooxymethyl)oxan-2-yl]oxybenzoic acid | present | LOTUS |
05DNA & barcoding36 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mimosa pudica has left across the world's sequence archives.
At a glance
DNA specimens36
Marker genes6
GenBank sequences10
eDNA detections19
Countries7
The DNA barcodea real sequence read deposited for this species
GTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGTGT …
Mimosa pudica voucher CTU-CNS MT16 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL6★rbcLa★ITS2★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Mimosa pudica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size586 800 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Mimosa pudica0.59 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 52 n = 26
Ploidy4× tetraploid · measured
Chromosome records32–782n range52median52mode18records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 5214×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +6
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Shibata, K. 1962. Estudios citologicos de plantas colombianas silvestres y cultivadas. J. Agric. Sci. (Tokyo). 8: 49–62.
CCDB · ipcn-api-dl — Yeh, M. S., H. YUASA & F. Maekawa. 1986. Chromosome numbers in the Leguminosae. Sci. Rep. Res. Inst. Evol. Biol. 3: 57–71.
CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1977. Evolutionary status of Leguminosae from Pachmarhi, central India. Nucleus 20: 94–98.
CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang & C. b. Chen. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 3, Chromosome Atlas of Garden Flowering Plants in China. Science Press, Beijing.
CCDB · book-ipcn75-78 — Bir & Kumari 1977
CCDB · book-indian_vol1 — Tjio, J.H. 1948 ; Berger, C.A. et al. 1958 ; Shibata, K. 1962b ; Bandel, G. 1974
CCDB · eflora
CCDB · book-fedorov — Tjio 1948
CCDB · book-fedorov — Berger C. A. et al. 1958
CCDB · book-fedorov — Shibata 1962b
CCDB · book-atlas-flowering-plants — FoHM Brazil
CCDB · kew — Bennett MD, Leitch IJ, Hanson L. 1998. DNA amounts in two samples of angiosperm weeds. Annals of Botany 82 (Supplement A): 121-134.
CCDB · Cave1963 — Shibata 1962
2n 482×CCDB · book-ipcn73-74 · CCDB · book-indian_vol1
CCDB · book-ipcn73-74 — SINHA, S.S.N., R. PRASAD, & R. KESWAMI. 1972. Cytological studies in some medicinal plants of Chhotanagpur. Proc. Indian Sci. Congr. Assoc. 59(III): 349.
CCDB · book-indian_vol1 — Sinha, S.S.N. et al. 1972
2n 321×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — BANDEL, G. 1974. Chromosome numbers and evolution in the Leguminosae Caryologia 27: 17-32.
2n 781×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Nazeer, M. A. & K. J. Madhusoodanan. 1983. Intraspecific polyploidy in Mimosa pudica Linn. Curr. Sci. 52: 128–129.
n 265×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78
CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA & U. Chatterjee. 1972. Chromosome survey of certain angiosperms. I. Bull. Bot. Surv. India 14: 170.
CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA & U. Chatterjee. 1972. Chromosome survey of certain angiosperms---I. Bull. Bot. Surv. India 14: 170.
CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1977. Evolutionary status of Leguminosae from Pachmarhi, central India. Nucleus 20: 94–98.
CCDB · book-ipcn75-78 — Sarkar et al. 1972
CCDB · book-ipcn75-78 — Bir & Kumari 1977
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
Completeness86.5% BUSCO
08Occurrence & distribution
Record type26 116 records
Wild obs. + sensor21 590
Museum / vouchered3 965
Cultivated / captive6
Other555
Origin
Native463
Introduced224
Range
Area of Occupancy AOO57 872 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy86% within 1 km
≤100 m 10 515≤1 km 2 177≤10 km 1 312>10 km 676
14 680 georeferenced · 6 910 without coordinates
Open the mapobservation + sensor21 590
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy74% within 1 km
≤100 m 409≤1 km 95≤10 km 143>10 km 32
679 georeferenced · 3 286 without coordinates
Open the institutions mapphysical evidence3 965
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤1 km 1
1 georeferenced · 5 without coordinates
Open the mapnot free-living6
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions141 of 345 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 452 |
| Durango, MX | 327 |
| Paris, FR | 157 |
| National Biodiversity Institute, Costa Ricalocation not on record | 112 |
| Université de Strasbourglocation not on record | 106 |
| Mexico City, MX | 79 |
| Kew, GB | 73 |
| Bronx, US | 61 |
| Laboratorio de Ictiologialocation not on record | 54 |
| Masindi, UG | 53 |
| Kathmandu, NP | 48 |
| Universidade Federal de Sergipe (UFS)location not on record | 45 |
| Taipei, TW | 44 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 41 |
| Baroda, IN | 38 |
| JBRJlocation not on record | 35 |
| Chicago, US | 34 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 33 |
| University of Stellenboschlocation not on record | 33 |
| Antiguo Cuscatlán, SV | 32 |
| Guangzhou, CN | 32 |
| Blumenau, BR | 32 |
| Beijing, CN | 30 |
| Universidad de Caldas (UCaldas)location not on record | 29 |
| Smithfield, AU | 29 |
| Chaguaramas, TT | 28 |
| Museo Entomologico de Leonlocation not on record | 26 |
| MeiseBGlocation not on record | 23 |
| TAIElocation not on record | 22 |
| Universidad Nacional de Colombia (UNAL)location not on record | 20 |
| Taipei, TW | 20 |
| Kunming, CN | 20 |
| Salvador, BR | 20 |
| Universidad de Antioquia (UdeA)location not on record | 18 |
| Universidade Federal do Maranhãolocation not on record | 18 |
| Berlin, DE | 18 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 18 |
| Plocation not on record | 18 |
| Universidad de La Salle (La Salle)location not on record | 18 |
| Tampa, US | 17 |
| UEPAlocation not on record | 16 |
| Mérida, MX | 16 |
| Canberra, AU | 16 |
| Altos de Pipe, VE | 16 |
| Feira de Santana, BR | 15 |
| Moscow State Universitylocation not on record | 15 |
| Austin, US | 15 |
| León, NI | 15 |
| MEXUlocation not on record | 15 |
| Tapachula, MX | 15 |
| Durham, US | 14 |
| Yaoundé, CM | 14 |
| UEMAlocation not on record | 14 |
| UNIVASFlocation not on record | 13 |
| Cenargenlocation not on record | 13 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 12 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 12 |
| Tuxtla Gutiérrez, MX | 12 |
| Mérida, MX | 12 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 12 |
| San José, CR | 11 |
| WAGlocation not on record | 11 |
| Porto Alegre, BR | 11 |
| Riverside, US | 11 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 11 |
| Brasília, BR | 11 |
| LDlocation not on record | 11 |
| Honolulu, US | 11 |
| UFMSlocation not on record | 10 |
| Ann Arbor, US | 10 |
| South Kensington, GB | 10 |
| UFBAlocation not on record | 10 |
| San Francisco de Campeche, MX | 10 |
| UFPElocation not on record | 10 |
| Museu Paraense Emílio Goeldilocation not on record | 10 |
| Universidad Industrial de Santander (UIS)location not on record | 10 |
| Herbier National du Gabonlocation not on record | 10 |
| LBVlocation not on record | 10 |
| Brisbane, AU | 9 |
| UnBlocation not on record | 9 |
| Ilhéus, BR | 9 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 9 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 9 |
| MAlocation not on record | 9 |
| Guatemala City, GT | 8 |
| Tuxtla Gutiérrez, MX | 8 |
| Chapingo, MX | 8 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 8 |
| BISHlocation not on record | 8 |
| Auckland, NZ | 8 |
| UNICAMPlocation not on record | 8 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 8 |
| Adam Mickiewicz University in Poznańlocation not on record | 8 |
| Istituto Agrario Castelnuovolocation not on record | 8 |
| Area de Conservacion Guanacastelocation not on record | 7 |
| Pondicherry, IN | 7 |
| UNESClocation not on record | 7 |
| Departamento de Sistematica e Ecologialocation not on record | 7 |
| UFRPElocation not on record | 7 |
| Nishihara, JP | 7 |
| National Institute of Biological Resourceslocation not on record | 6 |
| ESALQlocation not on record | 6 |
| Toluca, MX | 6 |
| CEPLAClocation not on record | 6 |
| ASUlocation not on record | 6 |
| Austin, US | 6 |
| Uppsala, SE | 6 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 6 |
| Cambridge, US | 6 |
| Universidad Católica de Oriente (UCO)location not on record | 6 |
| Wuhan, CN | 6 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 6 |
| Leiden University Medical Centerlocation not on record | 6 |
| UFPIlocation not on record | 6 |
| Nanjing, CN | 5 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 5 |
| 云南省思茅市民族传统医药研究所location not on record | 5 |
| Mount Annan, AU | 5 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 5 |
| UNESP-ISlocation not on record | 5 |
| Taipei, TW | 5 |
| Ivano-Frankivsk, UA | 5 |
| Cuiabá, BR | 5 |
| Armidale, AU | 5 |
| Universidade Federale do Rio Grande do Sullocation not on record | 5 |
| USP-IBlocation not on record | 5 |
| Palmerston, AU | 5 |
| Maringá, BR | 5 |
| Mexico City, MX | 5 |
| Cambridge, US | 4 |
| University of Papua New Guinealocation not on record | 4 |
| Instituto Nacional de Biodiversidad Herbario, Costa Ricalocation not on record | 4 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 4 |
| Brussels, BE | 4 |
| EL PASO, US | 4 |
| UFMGlocation not on record | 4 |
| Odawara, JP | 4 |
| HUAlocation not on record | 4 |
| University of Zhejianglocation not on record | 4 |
| Miami, US | 4 |
| Edinburgh, GB | 4 |
| UNESP, Campus São José Rio Prêtolocation not on record | 4 |
| UFESlocation not on record | 4 |
| Xiamen, CN | 4 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 4 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 4 |
| Cruz das Almas, BR | 4 |
| Criciúma, BR | 4 |
| Guilin, CN | 4 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 3 |
| Cascavel, BR | 3 |
| Riobamba, EC | 3 |
| Dehra Dun, IN | 3 |
| Nagasaki University - Fisherieslocation not on record | 3 |
| Universiti Sains Malaysialocation not on record | 3 |
| Autlán de Navarro, MX | 3 |
| IECOSlocation not on record | 3 |
| Culiacán, MX | 3 |
| Nishihara, JP | 3 |
| UFSClocation not on record | 3 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 3 |
| Montpellier, FR | 3 |
| Universidad de los Llanos (UniLlanos)location not on record | 3 |
| INMAlocation not on record | 3 |
| Federal University of Espírito Santolocation not on record | 3 |
| UEMlocation not on record | 3 |
| Brasília, BR | 3 |
| Loja, EC | 3 |
| Mexico City, MX | 3 |
| James Cook Townsvillelocation not on record | 3 |
| Hobart, AU | 3 |
| UESBlocation not on record | 3 |
| CPATSAlocation not on record | 3 |
| UTFPR-CPlocation not on record | 3 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 3 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 3 |
| QCNElocation not on record | 3 |
| HNBlocation not on record | 3 |
| BMlocation not on record | 2 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 2 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 2 |
| Foz do Iguaçu, BR | 2 |
| EFGlocation not on record | 2 |
| Bogotá, D.C., CO | 2 |
| Fortaleza, BR | 2 |
| Claremont, US | 2 |
| Cibinong Science Center, Herbarium Bogorienselocation not on record | 2 |
| UNIVILLElocation not on record | 2 |
| CNF-UFHBlocation not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| HUENFlocation not on record | 2 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 2 |
| Tempe, US | 2 |
| Juriquilla, MX | 2 |
| Nagano City, JP | 2 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 2 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 2 |
| Peking Universitylocation not on record | 2 |
| CASlocation not on record | 2 |
| UNESP-RClocation not on record | 2 |
| Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record | 2 |
| Toronto, CA | 2 |
| UFAClocation not on record | 2 |
| UNESP-IBILCElocation not on record | 2 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 2 |
| Santa Cruz de la Sierra, BO | 2 |
| OTSlocation not on record | 2 |
| Museo de Historia Natural de El Salvadorlocation not on record | 2 |
| Universidad del Valle (UV)location not on record | 2 |
| Instituto de Investigação Científica Tropicallocation not on record | 2 |
| UFPRlocation not on record | 2 |
| PUC-RSlocation not on record | 2 |
| Cambridge University Herbariumlocation not on record | 2 |
| Santarém, BR | 2 |
| HUT Culture Collectionlocation not on record | 2 |
| TNMlocation not on record | 2 |
| Herbario de la Universidad Técnica del Nortelocation not on record | 2 |
| CJBGlocation not on record | 2 |
| Elocation not on record | 2 |
| Cochabamba, BO | 2 |
| St. Augustine, TT | 2 |
| Changsha, CN | 2 |
| Calabar, NG | 2 |
| TAFORI-LSRClocation not on record | 2 |
| EAlocation not on record | 2 |
| Puebla, MX | 2 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 2 |
| Jataí / Setor Industrial, BR | 2 |
| Angwin, US | 2 |
| Stockholm, SE | 2 |
| Santa Teresa, BR | 2 |
| Universidad de los Andes (UniAndes)location not on record | 2 |
| FUNEDlocation not on record | 2 |
| UAMIZlocation not on record | 2 |
| UFSMlocation not on record | 2 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 2 |
| Toyama, JP | 1 |
| UFOPlocation not on record | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Boise, US | 1 |
| Campo Mourão, BR | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| Guangxi Agricultural Universitylocation not on record | 1 |
| Chengdu, CN | 1 |
| Shenzhen, CN | 1 |
| Fundación Estación Biológica Guayacanallocation not on record | 1 |
| Santiago de Cali, CO | 1 |
| San Isidro, AR | 1 |
| Whitehorse, CA | 1 |
| La Paz, BO | 1 |
| LISClocation not on record | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
| Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record | 1 |
| Jiangxi College of Traditional Chinese Medicinelocation not on record | 1 |
| Sanda, JP | 1 |
| Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record | 1 |
| 黔东南州民族医药研究所标本室location not on record | 1 |
| Universidad Nacional Agrarialocation not on record | 1 |
| Nanjing, CN | 1 |
| Wlocation not on record | 1 |
| Alcaldía Municipal de Garzón en Huilalocation not on record | 1 |
| Managua, NI | 1 |
| Wuhan, CN | 1 |
| Institut de Recherche Agronomique de Guinée (IRAG)location not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| Puerto Ayora, EC | 1 |
| LGlocation not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Universidad de Pamplona (UPamplona)location not on record | 1 |
| CMULlocation not on record | 1 |
| Universidad de Córdoba (UniCórdoba)location not on record | 1 |
| Instituto do Meio Ambientelocation not on record | 1 |
| Universidad de Guayaquillocation not on record | 1 |
| Centre National des Semences Forestièreslocation not on record | 1 |
| Université Nangui Abrogoualocation not on record | 1 |
| PHlocation not on record | 1 |
| Madison, US | 1 |
| Universidade Paulistalocation not on record | 1 |
| FLASlocation not on record | 1 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 1 |
| arosemena tola, EC | 1 |
| Kochi, JP | 1 |
| Cusco, PE | 1 |
| Castelar, AR | 1 |
| Universidad Nacional Federico Villarreallocation not on record | 1 |
| Université du Lomélocation not on record | 1 |
| Seychelles National Herbariumlocation not on record | 1 |
| Los Angeles, US | 1 |
| FUVATESlocation not on record | 1 |
| UNITINSlocation not on record | 1 |
| Akita Prefectural Museumlocation not on record | 1 |
| Institut de Recherche pour le Developpement (IRD)location not on record | 1 |
| San Diego, US | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| *unvoucheredlocation not on record | 1 |
| Seropédica, BR | 1 |
| Durban, ZA | 1 |
| Vancouver, CA | 1 |
| Knox Collegelocation not on record | 1 |
| Université National du Béninlocation not on record | 1 |
| Smithsonian Institution, National Museum of Natural Historylocation not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Pretoria, ZA | 1 |
| FPMZBlocation not on record | 1 |
| University of Hamburglocation not on record | 1 |
| Adelaide, AU | 1 |
| Montecillo, Texcoco, MX | 1 |
| Universidad de Córdoba (UC)location not on record | 1 |
| Kensington, AU | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Conservatoire Botanique National de Mascarinlocation not on record | 1 |
| UFSCarlocation not on record | 1 |
| Londrina, BR | 1 |
| Centro Cultural Santo Domingolocation not on record | 1 |
| Sangmiung Universitylocation not on record | 1 |
| Zürich, CH | 1 |
| URCAlocation not on record | 1 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 1 |
| UFRRJlocation not on record | 1 |
| Tsukuba, JP | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| Northridge, US | 1 |
| MEXlocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Xian, CN | 1 |
| Université de Bordeauxlocation not on record | 1 |
| UNEMATlocation not on record | 1 |
| Millersville, US | 1 |
| IAvHlocation not on record | 1 |
| UNESP-FCAlocation not on record | 1 |
| Awka, NG | 1 |
| Hanshan Normal Universitylocation not on record | 1 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Yangling, CN | 1 |
| KR | 1 |
| La Trobe Universitylocation not on record | 1 |
| UNISANTAlocation not on record | 1 |
| KOMlocation not on record | 1 |
| BRLUlocation not on record | 1 |
| Chiba, JP | 1 |
| Universidade Federal do Vale do São Franciscolocation not on record | 1 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
345 institutions · 3 510 of 3 965 vouchered records shown · 454 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA19 detections
Where the DNA of Mimosa pudica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found19
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 19 detections have coordinates
Open the map6 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median23.8 °C 17.2–25.7
Seasonal swing summer↔winter2.50 °C
Max temp (day)26.6 °C 22.5–29.5
Min temp (night)20.8 °C 12.6–22.6
Precipitation403 mm/mo 64.1–706
Air humidity70.8 % 58.2–76.0
Moisture balance264 mm/mo -82.3–594
Vapour deficit861 Pa 665–1,317
Wind speed2.60 m/s 0.7–3.90
Cloud cover43.8 % 26.6–53.7
CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.