Mimetillus moloneyi

(Thomas, 1891) · species

image placeholder — illustration coming later

Animalia/Chordata/Mammalia/Chiroptera/Vespertilionidae/Mimetillus

At a glance

Occurrence records694

Data sources8

Biological traits11

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Mimetillus moloneyi's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility694 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF694 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

Moloney's mimic bat (Mimetillus moloneyi) is a species of vesper bat. It can be found in Benin, Cameroon, Central African Republic, Republic of the Congo, Democratic Republic of the Congo, Ivory Coast, Equatorial Guinea, Ethiopia, Gabon, Ghana, Guinea, Kenya, Liberia, Mozambique, Nigeria, Sierra Leone, South Sudan, Tanzania, Togo, Uganda, and Zambia. It is found in subtropical or tropical dry or moist forests, subtropical or tropical mangrove forests, subtropical or tropical moist montane forests, dry and moist savanna.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPanTHERIAAmnioteDBEltonTraits

Size & morphology3

Body mass8.89 g

Forearm length28 mm

SVL6 cm

Life cycle & reproduction1

Litter size0.98

Diet & foraging1

Invertebrate100 %

Habitat & environment2

Habitat breadth1

Terrestriality2.00

Physiology & chemistry2

Precipitation mean124 mm

Temperature mean238 decidegC

Other traits2

Activity cycle-999.00

Foraging stratumA

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mimetillus moloneyi has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P659 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.5%

Haplotypes2

BIN1

Most divergent pair1.1%

Where individuals differ — all 15 variable positions, in barcode order

20Tvariable

158Tvariable

167Avariable

224Tvariable

281Tvariable

290Tvariable

311Avariable

314Gvariable

317Avariable

344Tvariable

395Cvariable

419Gvariable

440Tvariable

558Cvariable

602Cvariable

GAACTTTATACTTATTATTTGGTGCTTGAGCTGGTATAGTAGGTACTTCACTAAGTCTTTTAATTCGAGCTGAGTTAGGACAGCCTGGGG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nyctophilus geoffroyisame family15.5%Myotis sodalissame family15.6%Metachirus nudicaudatussame order15.8%Myotis daubentoniisame family16.0%Myotis blythiisame family16.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type694 records

Wild obs. + sensor625

Museum / vouchered69

Origin

Native10

Range

Area of Occupancy AOO292 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 1>10 km 1

3 georeferenced · 622 without coordinates

Open the mapobservation + sensor625

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤1 km 15≤10 km 9>10 km 1

25 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence69

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Toronto, CA	21
Chicago, US	15
Los Angeles, US	10
Brussels, BE	7
RBINS-Scientific Heritagelocation not on record	6
Geneva, CH	3
Paris, FR	2
Washington, US	1
Bonn, DE	1
Harrison Institutelocation not on record	1

10 institutions · 67 of 69 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Mimetillus moloneyi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.2 °C 28.2–28.2

Seasonal swing summer↔winter5.70 °C

Max temp (day)34.9 °C

Min temp (night)22.7 °C

Precipitation1.00 mm/mo

Air humidity38.2 %

Moisture balance-176 mm/mo

Vapour deficit2,365 Pa

Wind speed3.20 m/s

Cloud cover10.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)