Mimetes cucullatus

(L.) R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Mimetes

At a glance

Occurrence records4 458

Data sources10

Biological traits23

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Mimetes cucullatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 458 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF4 458 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Mimetes cucullatus is an evergreen shrub with several, mostly not branching, upright stems of 1–2 m (3–7 ft) high, that has been assigned to the family Proteaceae. It is the most widespread and most common pagoda species that can cope with a relatively large range of environmental circumstances. It is known under several names including common pagoda in English and rooistompie in Afrikaans.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height1.5 m

Plant height max2 m

Plant height min1 m

Seed mass35.9 mg

Seed mass max37.03 mg

Seed mass min37.03 mg

Life cycle & reproduction3

Deciduousnessevergreen

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 200 m

Elevation min0 m

Epiphyteterrestrial

Growth formshrub

Mycorrhiza typenon-ectomycorrhizal

Woodinesswoody

Physiology & chemistry4

Leaf n4.94 mg/g

Leaf p0.216 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)4.67 mm²/mg

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mimetes cucullatus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences8

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ481390.1 ↗604 bp

ACGT

ATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTGCCCAGCAGAGAGACCCGTG …

Mimetes cucullatus isolate C20S internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Mimetes cucullatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidypolyploid inferred

Chromosome records24–242n range24median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — de Vos 1943

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 458 records

Wild obs. + sensor4 096

Museum / vouchered362

Range

Area of Occupancy AOO3 044 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 3 198≤1 km 319≤10 km 99>10 km 30

3 646 georeferenced · 450 without coordinates

Open the mapobservation + sensor4 096

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤1 km 1≤10 km 6

7 georeferenced · 355 without coordinates

Open the institutions mapphysical evidence362

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	161
Pretoria, ZA	140
Cape Town, ZA	29
GHPG$location not on record	7
Claremont, US	3
Paris, FR	3
Christchurch, NZ	3
Philadelphia, US	2
Bronx, US	1
South African National Biodiversity Institutelocation not on record	1
South African Environmental Observations Networklocation not on record	1
University of Johannesburglocation not on record	1
Boise, US	1
Moscow State Universitylocation not on record	1
Civico Museo di Scienze naturali Giuseppe Orlandilocation not on record	1
MSB-3054location not on record	1
Uppsala, SE	1
Auckland, NZ	1
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	1

19 institutions · 359 of 362 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Mimetes cucullatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.8 °C 11.0–12.5

Seasonal swing summer↔winter8.60 °C

Max temp (day)15.8 °C 14.8–16.8

Min temp (night)7.80 °C 5.40–10.2

Precipitation91.5 mm/mo 45.8–137

Air humidity58.7 % 55.4–61.9

Moisture balance0.8 mm/mo -26.5–28.1

Vapour deficit566 Pa 550–581

Wind speed4.90 m/s 3.90–6.00

Cloud cover10.2 % 7.70–12.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mimetes cucullatus

At a glance

Sources10 archives

Size & morphology6

Life cycle & reproduction3

Diet & foraging1

Habitat & environment9

Physiology & chemistry4

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 458 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 458 records