Mimela junii

(Duftschmid, 1805) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scarabaeidae/Mimela

At a glance

Occurrence records1 998

Data sources7

Biological traits0

DNA specimens8

eDNA detections6

Sources7 archives

Databases and archives Mimela junii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 998 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 998 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD8 specimens

01Narrative

Mimela junii is a species of shining leaf chafer belonging to the family Scarabaeidae subfamily Rutelinae. These scarabs are mainly present in Austria, France, Italy and Switzerland. The head, pronotum and the inner margin of elytra are metallic-green, antennae are reddish, while elytra are coppery-brown, with longitudinal darker stripes. The adults can be encountered from June (hence the Latin word junii) through July on flowers, especially on elder flowers (Sambucus species). The adults beetles mainly feed on leaves of various wild shrubs and grasses, while larvae prefer sandy soils and are rhizophagous, feeding on roots at the expense of psammophilous and herbaceous plants or on decaying vegetables.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mimela junii has left across the world's sequence archives.

At a glance

DNA specimens8

BINs3

Marker genes1

eDNA detections6

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 49 variable positions, in barcode order

1Gvariable

28Amostly conserved

50Tmostly conserved

85Cmostly conserved

94Cmostly conserved

127Cmostly conserved

133Cmostly conserved

157Tmostly conserved

166Amostly conserved

169Cvariable

181Tmostly conserved

202Amostly conserved

205Tvariable

208Tmostly conserved

212Tvariable

220Cvariable

238Cvariable

244Amostly conserved

259Cmostly conserved

262Gmostly conserved

271Cmostly conserved

278Cvariable

280Amostly conserved

292Gmostly conserved

301Avariable

316Tvariable

325Amostly conserved

358Tvariable

400Tmostly conserved

418Cmostly conserved

427Tmostly conserved

451Tmostly conserved

508Tmostly conserved

514Tmostly conserved

518Gmostly conserved

521Tmostly conserved

532Amostly conserved

541Avariable

553Amostly conserved

565Tmostly conserved

571Cmostly conserved

574Amostly conserved

604Tmostly conserved

619Gmostly conserved

622Amostly conserved

628Amostly conserved

637Tmostly conserved

646Cvariable

649Amostly conserved

GACTCTATATTTCCTGTTCGGAAGATGAGCTGGAATAGTAGGAACTTCATTAAGATTACTTATTCGAGCAGAACTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes4

BINs3

Most divergent pair4.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anomala vitissame family11.9%Phyllopertha diversasame family12.0%Exomala orientalissame family12.0%Anomala luculentasame family12.3%Exomala pallidipennissame family12.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 998 records

Wild obs. + sensor1 979

Museum / vouchered17

Fossil1

Other1

Range

Area of Occupancy AOO3 352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 640≤1 km 141≤10 km 677>10 km 26

1 484 georeferenced · 495 without coordinates

Open the mapobservation + sensor1 979

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 3≤1 km 5≤10 km 6

14 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	8
South Kensington, GB	4
ZSMlocation not on record	1

3 institutions · 13 of 17 vouchered records shown · 4 without an institution code

09Environmental DNA6 detections

Where the DNA of Mimela junii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

Estuaire et zones sableuses

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.4 °C 18.3–22.4

Seasonal swing summer↔winter14.7 °C

Max temp (day)23.5 °C 21.2–26.7

Min temp (night)18.1 °C 13.9–18.7

Precipitation34.7 mm/mo 23.6–46.3

Air humidity60.2 % 53.8–61.8

Moisture balance-125 mm/mo -144–-86.3

Vapour deficit1,001 Pa 818–1,254

Wind speed2.40 m/s 2.00–3.30

Cloud cover37.3 % 36.6–42.1

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mimela junii

At a glance

Sources7 archives

At a glance

Record type1 998 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 3 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 998 records