Miltonia regnellii

Rchb.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Miltonia

At a glance

Occurrence records114

Data sources10

Biological traits12

DNA specimens5

eDNA detections4

Sources10 archives

Databases and archives Miltonia regnellii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility114 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF114 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB · GoaT4.6 Gbp

01Narrative

Miltonia regnellii, the Regnell's miltonia, is a species of orchid occurring in southeastern and southern Brazil.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formpseudobulbous epiphyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 200 m

Elevation min300 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTCampo de Altitude, Floresta Ciliar ou Galeria, Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial)

Woodinessnon-woody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Miltonia regnellii has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences6

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEF079409.1 ↗732 bp

ACGT

AGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGATCGAAAAATACATCGAGTGATTCGAACAA …

Miltonia regnellii 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Miltonia regnellii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 596 600 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Miltonia regnellii4.6 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Ploidydiploid inferred

Chromosome records48–602n range60median60mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 604×GoaT · Kew Plant DNA C-values Database · CCDB · book-fedorov · CCDB · kew +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-fedorov — Sinoto 1962

CCDB · kew — Hanson L, Leitch IJ, Bennett MD. 1999. Unpublished values from the Jodrell Laboratory, Royal Botanic Gardens, Kew.

CCDB · Cave1962 — Sinoto 1962

2n 481×CCDB · book-fedorov

CCDB · book-fedorov — Shimoya 1956

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type114 records

Wild obs. + sensor24

Museum / vouchered90

Origin

Native27

Range

Area of Occupancy AOO228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 14≤1 km 3≤10 km 1>10 km 1

19 georeferenced · 5 without coordinates

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤1 km 3≤10 km 1>10 km 1

5 georeferenced · 85 without coordinates

Open the institutions mapphysical evidence90

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Blumenau, BR	28
San Jose State University, Museum of Birds and Mammalslocation not on record	18
Stockholm, SE	6
Maringá, BR	5
Bronx, US	4
UEMlocation not on record	4
Pontifícia Universidade Católica do Paranálocation not on record	4
Denver, US	3
Pontifícia Universidade Católica do Paranálocation not on record	3
Chicago, US	2
Campo Mourão, BR	1
Ivano-Frankivsk, UA	1
Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record	1
UNICAMPlocation not on record	1
JBRJlocation not on record	1
FUVATESlocation not on record	1
Departamento de Sistematica e Ecologialocation not on record	1
UFSClocation not on record	1
South Kensington, GB	1
LDlocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1
Ural Federal University "B. N. Yeltsin"location not on record	1
UTFPR-CPlocation not on record	1

23 institutions · 90 of 90 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Miltonia regnellii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)