Milligania lindoniana

Rodway ex W.M.Curtis · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asteliaceae/Milligania

At a glance

Occurrence records146

Data sources4

Biological traits26

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Milligania lindoniana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility146 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF146 records

DNA & barcodingNCBIsequences

01Narrative

Milligania lindoniana là một loài thực vật có hoa trong họ Asteliaceae. Loài này được Rodway ex W.M.Curtis mô tả khoa học đầu tiên năm 1972.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Fruit length6 mm

Leaf length125 mm

Leaf size3 770 mm²

Leaf width17 mm

Plant height0.4 m

Seed length1.5 mm

Seed mass0.241 mg

Seed mass max0.24 mg

Seed mass min0.24 mg

Seed width1 mm

Life cycle & reproduction5

Flowering timeyynnnnnnnnny

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapelanceolate

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Milligania lindoniana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

rbcLMZ047964.1 ↗1 323 bp

ACGT

GATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCAGCGGTAGCTGCCGAATCTTCT …

Milligania lindoniana voucher JLB371 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type146 records

Wild obs. + sensor73

Museum / vouchered73

Origin

Native4

Range

Area of Occupancy AOO160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 47≤1 km 4≤10 km 20

71 georeferenced · 2 without coordinates

Open the mapobservation + sensor73

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 1≤1 km 42≤10 km 19>10 km 1

63 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence73

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hobart, AU	34
Canberra, AU	12
Museo Entomologico de Leonlocation not on record	8
Armidale, AU	5
Adelaide, AU	5
Mount Annan, AU	4
QVMAGlocation not on record	2
MAlocation not on record	1
US	1
Auckland, NZ	1

10 institutions · 73 of 73 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)