Millettia stuhlmannii

Taub. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Millettia

At a glance

Occurrence records240

Data sources9

Biological traits21

DNA specimens14

eDNA detections6

Sources9 archives

Databases and archives Millettia stuhlmannii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility240 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Chemical compositionNPASS3 compounds

Occurrence & distributionGBIF240 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI14 specimens

01Narrative

Millettia stuhlmannii, commonly known as panga panga, is a well-known species of timber tree that is native to the southeastern Afrotropics. The wood of the tropical species M. laurentii has similar qualities and uses, but is slightly darker, and lacks the copious yellowish white resin of the heartwood vessels. Its foliage is similar to that of Pterocarpus rotundifolius, and it may be confused with the latter when observed from a distance. Panga Panga is often mistakenly called Partridge Wood, this is incorrect and an entirely different Genus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height15 m

Plant height max20 m

Plant height min3 m

Life cycle & reproduction5

Deciduousnessdeciduous

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max500 m

Elevation min100 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Wood density768 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition3 compounds

Compounds documented for Millettia stuhlmannii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavandiols (Leucoanthocyanidins)2

Flavonols1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3S,4S)-2-(3,4-Dihydroxyphenyl)-3,4-dihydro-2H-1-benzopyran-3,4,7-triol	present	NPASS
Peltogynan-4-alpha-ol	present	NPASS
Robinetin	present	NPASS

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Millettia stuhlmannii has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes4

GenBank sequences3

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLJX572773.1 ↗552 bpMozambique · 2010

ACGT

AGTGTTGGGTTTAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCA …

Millettia stuhlmannii voucher OM2522 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★trnL-F

plant barcode

08Occurrence & distribution

Record type240 records

Wild obs. + sensor21

Museum / vouchered101

Cultivated / captive118

Origin

Introduced1

Range

Area of Occupancy AOO328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 12≤1 km 1≤10 km 1>10 km 2

16 georeferenced · 5 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 1≤10 km 3

4 georeferenced · 97 without coordinates

Open the institutions mapphysical evidence101

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy5% within 1 km

≤1 km 6≤10 km 112

118 georeferenced

Open the mapnot free-living118

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto de Investigação Científica Tropicallocation not on record	43
Saint Louis, US	12
Kew, GB	7
South Kensington, GB	7
Pretoria, ZA	5
University of Johannesburglocation not on record	3
Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record	2
MAlocation not on record	1
TAFORI-LSRClocation not on record	1
Bronx, US	1
MeiseBGlocation not on record	1
Arusha, TZ	1
WAGlocation not on record	1
Eduardo Mondlane Universitylocation not on record	1
UJlocation not on record	1
Uppsala, SE	1

16 institutions · 88 of 101 vouchered records shown · 13 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Millettia stuhlmannii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

Deciduous woodland/Termitaria pan matrixMixed miombo Woodland on boulder inselberg

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 19.5–26.8

Seasonal swing summer↔winter6.80 °C

Max temp (day)29.7 °C 25.1–31.7

Min temp (night)21.8 °C 13.5–22.3

Precipitation120 mm/mo 52.1–215

Air humidity60.9 % 57.0–65.1

Moisture balance-17.0 mm/mo -73.6–57.0

Vapour deficit1,157 Pa 958–1,409

Wind speed1.80 m/s 1.60–2.20

Cloud cover35.7 % 13.1–61.2

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)