Millettia rhodantha

Baill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Millettia

At a glance

Occurrence records275

Data sources11

Biological traits17

DNA specimens4

eDNA detections2

Sources11 archives

Databases and archives Millettia rhodantha's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility275 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF275 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Millettia rhodantha is a plant species as described by Henri Ernest Baillon, found in Angola. A synonym to it is Millettia aromatica. Millettia rhodantha is included in the genus Millettia in the family Fabaceae. It grows to a height of 9 to. No subspecies are listed in the Catalogue of Life.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height12 m

Plant height max12.19 m

Plant height min9.14 m

Life cycle & reproduction5

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: climber

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Millettia rhodantha has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences2

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLMN366710.1 ↗528 bp

ACGT

GTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCC …

Millettia rhodantha voucher IDRCG968-13_FHO_EK6908 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Millettia rhodantha carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 121×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Gill, L. S. & S. W. Husaini. 1984. Cyto-morphology of the genus Millettia Wight & Arn. (Leguminosae) from Nigeria. Bol. Soc. Brot., sér. 2 57: 237–249.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type275 records

Wild obs. + sensor181

Museum / vouchered94

Range

Area of Occupancy AOO324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 7

7 georeferenced · 174 without coordinates

Open the mapobservation + sensor181

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 94 records without

Open the institutions mapphysical evidence94

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	11
Saint Louis, US	10
CNF-UFHBlocation not on record	8
WAGlocation not on record	8
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	7
MeiseBGlocation not on record	6
Adam Mickiewicz University in Poznańlocation not on record	6
BRLUlocation not on record	5
Herbier National du Gabonlocation not on record	3
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	2
Plocation not on record	2
University of Stellenboschlocation not on record	2
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	2
Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record	1
Paris, FR	1
University of Oxfordlocation not on record	1
Universite Libre de Bruxelles, Herbariumlocation not on record	1
Daubeny Herbarium, Oxfordlocation not on record	1

18 institutions · 77 of 94 vouchered records shown · 17 without an institution code

09Environmental DNA2 detections

Where the DNA of Millettia rhodantha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 24.0–27.2

Seasonal swing summer↔winter3.10 °C

Max temp (day)30.8 °C 29.3–32.2

Min temp (night)21.5 °C 19.6–23.4

Precipitation68.2 mm/mo 31.1–105

Air humidity62.6 % 61.8–63.4

Moisture balance-73.0 mm/mo -94.5–-51.4

Vapour deficit1,229 Pa 1,133–1,324

Wind speed1.70 m/s 1.30–2.20

Cloud cover26.4 % 26.2–26.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)