Millettia mossambicensis

J.B.Gillett · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Millettia

At a glance

Occurrence records57

Data sources7

Biological traits4

DNA specimens0

eDNA detections2

Sources7 archives

Databases and archives Millettia mossambicensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility57 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Occurrence & distributionGBIF57 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingNCBIsequences

01Narrative

Millettia mossambicensis is a species of plant in the family Fabaceae. It is endemic to central Mozambique, where it is fairly widespread in the low-lying woodlands and forests. The small trees are over-exploited for local construction purposes. The leaves have two or three pairs of leaflets and one terminal leaflet which is largest. Leaflets have 9 to 11 pairs of lateral, parallel veins. The purple-blue flowers are carried on racemes which appear in spring.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction1

Life formtree

Habitat & environment3

Climateseasonally dry tropical

Growth formtree

Woodinesswoody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Millettia mossambicensis has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJX572772.1 ↗552 bpMozambique · 2010

ACGT

AGTGTTGGGTTTAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCA …

Millettia mossambicensis voucher OM2335 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type57 records

Wild obs. + sensor1

Museum / vouchered56

Origin

Introduced31

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 56 records without

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
N/Alocation not on record	14
Instituto de Investigação Científica Tropicallocation not on record	13
LISClocation not on record	3
Kew, GB	2
University of Stellenboschlocation not on record	2
Eduardo Mondlane Universitylocation not on record	2
K,LISC,LMJlocation not on record	2
South Kensington, GB	2
BR,EOWBLlocation not on record	2
University of Johannesburglocation not on record	1
K,K,LISC,LMJlocation not on record	1
LISC,LMUlocation not on record	1
BR,K,LMU,WAGlocation not on record	1
MeiseBGlocation not on record	1
Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record	1
UJlocation not on record	1
BNRH,TCT-CATAPUlocation not on record	1
K,LISClocation not on record	1
Centro de Investigação Científica Algodoeiralocation not on record	1
INPA,LISC,LISClocation not on record	1

20 institutions · 53 of 56 vouchered records shown · 3 without an institution code

09Environmental DNA2 detections

Where the DNA of Millettia mossambicensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Sand Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.7 °C 26.3–27.1

Seasonal swing summer↔winter6.80 °C

Max temp (day)31.1 °C 30.4–31.7

Min temp (night)22.6 °C 22.5–22.7

Precipitation202 mm/mo 190–214

Air humidity62.8 % 61.0–64.6

Moisture balance44.6 mm/mo 42.9–46.3

Vapour deficit1,311 Pa 1,214–1,407

Wind speed2.00 m/s 1.80–2.20

Cloud cover60.9 % 58.7–63.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)