Millettia duchesnei

De Wild. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Millettia

At a glance

Occurrence records33

Data sources8

Biological traits5

DNA specimens3

eDNA detections1

Sources8 archives

Databases and archives Millettia duchesnei's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility33 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources5 traits

Chemical compositionLOTUS12 compounds

Occurrence & distributionGBIF33 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Millettia duchesnei là loài thực vật thuộc chi Millettia. Từ cành cây của loài này có thể chiết xuất ra các hợp chất rotenoid elliptol, 12-deoxo-12alpha-methoxyelliptone, 6-methoxy-6a,12a-dehydrodeguelin, 6a,12a-dehydrodeguelin, 6-hydroxy-6a,12a-dehydrodeguelin, 6-oxo-6a,12a-dehydrodeguelin, 12a-hydroxyelliptone và flavanone eriodictyol.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formclimber

Life spanperennial

Habitat & environment3

Climatewet tropical

Climberobligatory

Woodinesswoody

03Chemical composition12 compounds

Compounds documented for Millettia duchesnei across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Rotenoids7

Coumaronochromones $ Rotenoids1

Flavanones1

Documented compounds12 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Eriodictyol	present	LOTUS
(1)Benzopyrano(3,4-b)furo(2,3-h)(1)benzopyran-6(6aH)-one,12,12a-dihydro-6a-hydroxy-8,9-dimethoxy-, (6aS-cis)-	present	LOTUS
(1R,13S)-13-hydroxy-16,17-dimethoxy-2,7,20-trioxapentacyclo[11.8.0.03,11.04,8.014,19]henicosa-3(11),4(8),5,9,14,16,18-heptaen-12-one	present	LOTUS
(1S,12S,13S)-12,16,17-trimethoxy-2,7,20-trioxapentacyclo[11.8.0.03,11.04,8.014,19]henicosa-3(11),4(8),5,9,14,16,18-heptaene	present	LOTUS
(1S,13R)-16,17-dimethoxy-2,7,20-trioxapentacyclo[11.8.0.03,11.04,8.014,19]henicosa-3(11),4(8),5,9,14,16,18-heptaen-12-one	present	LOTUS
(22S)-17,18,22-trimethoxy-7,7-dimethyl-2,8,21-trioxapentacyclo[12.8.0.03,12.04,9.015,20]docosa-1(14),3(12),4(9),5,10,15,17,19-octaen-13-one	present	LOTUS
(22S)-22-hydroxy-17,18-dimethoxy-7,7-dimethyl-2,8,21-trioxapentacyclo[12.8.0.03,12.04,9.015,20]docosa-1(14),3(12),4(9),5,10,15,17,19-octaen-13-one	present	LOTUS
17,18-Dimethoxy-7,7-dimethyl-2,8,21-trioxapentacyclo[12.8.0.03,12.04,9.015,20]docosa-1(14),3(12),4(9),5,10,15,17,19-octaene-13,22-dione	present	LOTUS
[(4R)-6,7-dimethoxy-3,4-dihydro-2H-chromen-4-yl]-(4-hydroxy-1-benzofuran-5-yl)methanone	present	LOTUS
[(4S)-6,7-dimethoxy-3,4-dihydro-2H-chromen-4-yl]-(4-hydroxy-1-benzofuran-5-yl)methanone	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Millettia duchesnei has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMN366707.1 ↗528 bp

ACGT

GTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCC …

Millettia duchesnei voucher COBIN143-13_7226AA ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type33 records

Museum / vouchered33

Range

Area of Occupancy AOO68 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 33 records without

Open the institutions mapphysical evidence33

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	10
Adam Mickiewicz University in Poznańlocation not on record	6
Saint Louis, US	3
Yaoundé, CM	2
Herbier National du Gabonlocation not on record	1
National Botanical Gardens of Belgiumlocation not on record	1
LBVlocation not on record	1

7 institutions · 24 of 33 vouchered records shown · 9 without an institution code

09Environmental DNA1 detections

Where the DNA of Millettia duchesnei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 24.2–24.2

Seasonal swing summer↔winter1.00 °C

Max temp (day)29.8 °C

Min temp (night)20.2 °C

Precipitation42.1 mm/mo

Air humidity63.3 %

Moisture balance-81.4 mm/mo

Vapour deficit1,112 Pa

Wind speed1.60 m/s

Cloud cover53.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)