Millepora complanata

Lamarck, 1816 · species

image placeholder — illustration coming later

Animalia/Cnidaria/Hydrozoa/Anthoathecata/Milleporidae/Millepora

At a glance

Occurrence records16 901

Data sources12

Biological traits5

DNA specimens88

eDNA detections97

Sources12 archives

Databases and archives Millepora complanata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 923 records↗

OBISOcean Biodiversity Information System7 978 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI97 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics88 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS16 901 records

Environmental DNA1 datasets · 1 countries97 detections

DNA & barcodingBOLD88 specimens

Genome at a glanceGoaT · NCBI≈3 Gbp

01Narrative

Millepora complanata, commonly known as blade fire coral, is a species of fire coral in the family Milleporidae. It is found in shallow waters in the Caribbean Sea where it is a common species. The International Union for Conservation of Nature has assessed its conservation status as being of "least concern".

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonesessile

Other traits2

Depth max45 m

Depth min0 m

05DNA & barcoding88 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Millepora complanata has left across the world's sequence archives.

At a glance

DNA specimens88

BINs1

Marker genes1

eDNA detections97

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P385 bp consensus88 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

4Tmostly conserved

7Cmostly conserved

55Tmostly conserved

67Cvariable

73Cmostly conserved

107Tmostly conserved

115Cmostly conserved

116Tmostly conserved

133Amostly conserved

160Amostly conserved

166Tmostly conserved

167Cmostly conserved

175Amostly conserved

181Tmostly conserved

187Gmostly conserved

190Amostly conserved

211Tvariable

220Cmostly conserved

223Tmostly conserved

235Gmostly conserved

241Tmostly conserved

262Cmostly conserved

289Cmostly conserved

316Amostly conserved

349Cvariable

373Gvariable

376Avariable

CGCTTTCGTTATGATTTTTTTCTTAGTTATGCCTGTTCTCATTGGAGGGTTTGGTAATTGATTTGTCCCCCTCTACATAGGAGCCCCTGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 59 variants.

Diversity (π)2.0%

Haplotypes59

BIN1

Most divergent pair5.7%

Other

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Millepora complanata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈2 982 957 844 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Millepora complanata2.98 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness89.6% BUSCO

08Occurrence & distribution

Record type16 901 records

Wild obs. + sensor16 733

Museum / vouchered104

Fossil1

Other63

Range

Area of Occupancy AOO4 400 km²

Depth

0–200 m sunlit7 838

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 4.5 m · max 107 m · 7 838 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy15% within 1 km

≤100 m 116≤1 km 5≤10 km 18>10 km 691

830 georeferenced · 15 903 without coordinates

Open the mapobservation + sensor16 733

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 9≤1 km 5≤10 km 19>10 km 3

36 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence104

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto de Investigaciones Marinas y Costeras (INVEMAR)location not on record	9
CASlocation not on record	7
UM-RSMASlocation not on record	6
	4
Tapachula, MX	2
Universidad del Valle (UniValle)location not on record	2
Toronto, CA	2
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	1
Cambridge, US	1
New Haven, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
FCMMlocation not on record	1
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	1
Washington, US	1

14 institutions · 39 of 104 vouchered records shown · 16 without an institution code

09Environmental DNA97 detections

Where the DNA of Millepora complanata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found97

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 97 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 23.2–23.2

Seasonal swing summer↔winter4.20 °C

Max temp (day)25.5 °C

Min temp (night)21.6 °C

Precipitation22.8 mm/mo

Air humidity65.3 %

Moisture balance-137 mm/mo

Vapour deficit981 Pa

Wind speed4.30 m/s

Cloud cover27.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Millepora complanata

At a glance

Sources12 archives

Habitat & environment3

Other traits2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type16 901 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type16 901 records