Miliusa tomentosa

(Roxb.) J.Sinclair · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Magnoliales/Annonaceae/Miliusa

At a glance

Occurrence records65

Data sources9

Biological traits21

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Miliusa tomentosa's data was compiled from.

GBIFGlobal Biodiversity Information Facility65 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources21 traits

Chemical compositionNPASS3 compounds

Occurrence & distributionGBIF65 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass417 mg

Seed mass max435 mg

Seed mass min400 mg

Life cycle & reproduction3

Deciduousnessdeciduous

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Growth formtree

Woodinesswoody

Physiology & chemistry9

Leaf C:N ratio20.55 g/g

Leaf c449 mg/g

Leaf n19.33 mg/g

Leaf p1.4 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)11.99 mm²/mg

Wood density620 mg/cm³

Wood density max620 mg/cm³

Wood density min620 mg/cm³

03Chemical composition3 compounds

Compounds documented for Miliusa tomentosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Quinolizidine alkaloids2

Pyridine alkaloids $ Quinolizidine alkaloids1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Thermopsine	present	NPASS
CID 638233	present	NPASS
Hydrorhombinine	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Miliusa tomentosa has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

matKPX672594.1 ↗810 bpIndia · 2014

ACGT

GTGTCACATATACTAATACCTTACCCCGTCCATCTGGAAATCTTGGTTCAAATACTTTACTCTTGGATACAAGATGCTCCCTCTTTGCAT …

Miliusa tomentosa voucher CCMB_NP_27 maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Miliusa tomentosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 183×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-indian_vol1 — Adatia, R.D. & Chokshi, D.V. 1951

CCDB · book-fedorov — Adatia, Chokshi 1951

CCDB · book-atlas-flowering-plants — Adatia & C. 1951

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.961 ↗

08Occurrence & distribution

Record type65 records

Wild obs. + sensor44

Museum / vouchered21

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 13≤1 km 11≤10 km 3>10 km 5

32 georeferenced · 12 without coordinates

Open the mapobservation + sensor44

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 12

12 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	9
Baroda, IN	5
Ann Arbor, US	1
Dehra Dun, IN	1
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1

6 institutions · 18 of 21 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Miliusa tomentosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.0 °C 28.0–28.0

Seasonal swing summer↔winter11.9 °C

Max temp (day)33.9 °C

Min temp (night)22.1 °C

Precipitation28.8 mm/mo

Air humidity51.0 %

Moisture balance-127 mm/mo

Vapour deficit1,854 Pa

Wind speed2.20 m/s

Cloud cover3.90 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)