Milium effusum
speciesAt a glance
Occurrence records228 216
Data sources11
Biological traits47
DNA specimens58
eDNA detections140
Sources11 archives
Databases and archives Milium effusum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility228 216 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI140 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics58 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources47 traits
Occurrence & distributionGBIF228 216 records
Environmental DNA2 datasets · 10 countries140 detections
DNA & barcodingBOLD · NCBI58 specimens
Genome at a glanceCCDB · GoaT4.6 Gbp
01Narrative
Milium effusum, le Millet des bois, Millet diffus, Mil, Millet sauvage, Millet étalé ou Petit Millet, est une espèce de plante herbacée commune de la famille des Poaceae. Cette plante est native des forêts humides à fraiches de la zone holarctique. Elle est broutée par de nombreux mammifères herbivores forestiers.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology11
Leaf mass48.94 mg
Leaf size2 287 mm²
⚠ sources differ — TRY: 2 287 mm² · LEDA: 1 622 mm² · GIFT: 1 622 mm²
Plant height0.625 m
⚠ sources differ — GIFT: 0.625 m · LEDA: 0.625 m · TRY: 1.22 m
Plant height generative0.85 m
Plant height max1.8 m
Plant height min0.5 m
Seed length2.37 mm
Seed mass1.22 mg
⚠ sources differ — TRY: 1.22 mg · LEDA: 1.14 mg · GIFT: 1.14 mg
Seed volume0.99 mm³
Seed volume max0.99 mm³
Seed volume min0.99 mm³
Life cycle & reproduction13
Deciduousnessevergreen
Dispersal typewater
⚠ sources differ — LEDA: nautochor · GIFT: anemochorous
Flowering endAug
Flowering startMay
Life formperennial
Life spanperennial
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number280
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 500 m
Elevation mean2 100 m
Elevation min700 m
Epiphyteterrestrial
Fruit fleshinessdry
Growth formherb
⚠ sources differ — GIFT: herb · TRY: graminoid
Habitat GIFTforest
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio17.11 g/g
Leaf c458 mg/g
Leaf dry-matter content (LDMC)219 mg/g
⚠ sources differ — TRY: 219 mg/g · LEDA: 251 mg/g
Leaf n19.5 mg/g
Leaf p1.1 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)30.32 mm²/mg
⚠ sources differ — TRY: 30.32 mm²/mg · LEDA: 33.35 mm²/mg · GIFT: 33.35 mm²/mg
Other traits1
Diaspore typegenerative dispersule
05DNA & barcoding58 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Milium effusum has left across the world's sequence archives.
At a glance
DNA specimens58
Marker genes7
GenBank sequences10
eDNA detections140
Countries10
The DNA barcodea real sequence read deposited for this species
TCGTGACCCTGACCAAAACTGACCGTGAACGTGTCACCTACCTGGCTGGTAACGGCTCTGTCCGTTGCTTGGCCAAAATCCTCAACAACC …
Milium effusum voucher 29 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★rbcLa★ITS10★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Milium effusum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size4 635 720 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Milium effusum4.64 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy4× tetraploid · measured
Chromosome records14–882n range28median28mode83records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2875×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +13
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Váchová M., 1987: Karyological study of the Slovak flora XXI. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 34: 27-32.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · brit-fl — Tutin, T.G. Watsonia 1: 345-348 (1950)
CCDB · brit-fl — Bennett, S.T., Thomas, S.M. Genome 34: 868-878 (1991)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4420
CCDB · fl-europaea — V. Sorsa, 1.962
CCDB · poland — Frey L., Mirek Z. and Mizianty M. 1977. Contribution to the chromosome numbers of Polish vascular plants. Fragm. Flor. Geobot. 23, 317-325.
CCDB · poland — Skali?ska M., Pogan E., Czapik R. et al. 1978. Further studies in chromosome numbers of Polish Angiosperms. Twelfth contribution. Acta Biol. Cracov. Ser. Bot. 21, 31-63.
CCDB · mediterranean
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1981. Kariologicheskoe issledovanie sosudistykh rastenij ostrovov Dal'nevostocnogo gosudarstvennogo morskogo sapovednika. Sb. Cvetkaye Rastenija Ostrovov Dalnevostochnogo Morskogo Sapovednika. 92–114.
CCDB · ipcn-api-dl — Strid, A. & I. A. Andersson. 1985. Chromosome numbers of Greek mountain plants. An annotated list of 115 species. Bot. Jahrb. Syst. 107: 203–228.
CCDB · ipcn-api-dl — Frey, L., Z. Mirek & M. Mizianty. 1977. Contribution to the chromosome numbers of Polish vascular plants. Fragm. Florist. Geobot. 23: 317–325.
CCDB · ipcn-api-dl — Guzik, M. B. 1984. Khromosomnye chisla nekotorykh dikorastushchikh zlakov Predural'ja. Ekologija Opylenija Rastenij. Mezhvuzovskij Sbornik Nauchnykh Trudov. Perm. 82–86.
CCDB · ipcn-api-dl — Rudyka, E. G. 1990. Chromosome numbers of vascular plants from the various regions of the USSR. Bot. Žhurn. (Moscow & Leningrad) 75: 1783–1786.
CCDB · ipcn-api-dl — Sorokin, S. N. 1990. Chromosome numbers in members of the Poaceae family from the north-west of the European part of the USSR. Bot. Žhurn. (Moscow & Leningrad) 75: 1185.
CCDB · ipcn-api-dl — Duckert-Henriod, M. M. 1991. Mediterranean chromosome number reports 1 (7--25). Fl. Medit. 1: 229–236.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1987. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. II. Zapov. Belorussii Issl. 11: 62–69.
CCDB · ipcn-api-dl — Bennett, S. T. & S. M. Thomas. 1991. Karyological analysis and genome size in Milium (Gramineae) with special reference to polyploidy and chromosomal evolution. Genome 34: 868–878.
CCDB · ipcn-api-dl — Bennett, S. T. & M. D. Bennett. 1992. Variation in nuclear DNA amount between wild and cultivated populations of Milium effusum (2n = 28). Genome 35: 1050–1053.
CCDB · ipcn-api-dl — Ko|3zuharov, S. I. & A. V. Petrova. 1991. Chromosome numbers of Bulgarian angiosperms. Fitologija 39: 72–77.
CCDB · ipcn-api-dl — Skalinska, M. 1978. Further studies in chromosome numbers of Polish angiosperms. Twelfth contribution. Acta Biol. Cracov., Ser. Bot. 21: 31–63.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Probatova, N. S., E. G. Rudyka & S. A. Shatalova. 2001. Chromosome numbers in some plant species from the environs of Vladivostok city (Primorsky Region). Bot. Žhurn. (Moscow & Leningrad) 86(1): 168–172.
CCDB · ipcn-api-dl — Rodionov, A.V., E. O. Punina, M. A. Dobroradova, N. B. Tyupa & N. N. Nosov. 2006. Caryological study of the grasses (Poaceae): chromosome numbers of some Aveneae, Poeae, Phalarideae, Phleeae, Bromeae, Triticeae. Bot. Žhurn. (Moscow & Leningrad) 91(4): 615–627.
CCDB · ipcn-api-dl — Probatova. 2004. Chromosome numbers of some representatives of the flora of the Primorsky Territory. Bot. Žhurn. (Moscow & Leningrad) 89(7): 1209–1217.
CCDB · ipcn-api-dl — Ghukasyan. 2004. Extent of karyological study of Armenian grasses (Poaceae). Fl. Rastitel'n. Rastitel'n. Resursy Armenii 15: 85–89.
CCDB · ipcn-api-dl — Ghukasyan. 2004. On the karyology of the genus Milium L. (Poaceae). Fl. Rastitel'n. Rastitel'n. Resursy Armenii 15: 89–90.
CCDB · ipcn-api-dl — Seledets. 2005. Ecological area of species: karyological aspects. Pages 95--97 in Karyology, Karyosystematics and Molecular Phylogeny. St. Petersburg, Russia.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981a. In Chromosome number reports LXXI. Taxon 30: 509–511.
CCDB · ipcn-api-dl — Váchová, M. 1987. Karyological study of the Slovak flora XXI. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 34: 27–32.
CCDB · book-indian_vol2 — Avdulov, N.P. (Fedorov); Tischler, G. 1934 ; Rohweder, H. 1937 ; LCSve, A. & LOve, D. 1944b, I956b ; Sokolovskaya, A.P. & Strelkova, O.S. (Fedorov) ; Tateoka, T. 1953 ; Hub- bard, C.E. 1954; Bowden, W.M. I960b ; Sokolovskaya, A.P. (Fedorov) ; Sorsa, V. 1962, 1963b ; Gadella, T.W.J. & Kliphuis, B. 1963; Mehra, P.N. & Sunder, S. 1969
CCDB · book-fedorov — AB):IYJIOB 1928
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Rohweder 1937
CCDB · book-fedorov — LOve A., Love D. 1944b, 1956b Mnes
CCDB · book-fedorov — CoKOJIOBCKaJI, CTpeJI- laevis
+32 more references
2n 145×CCDB · mediterranean · CCDB · book-indian_vol2 · CCDB · book-fedorov +1
CCDB · mediterranean
CCDB · book-indian_vol2 — Sokolovskaya, A.P. & Strelkova, O.S. (Fedorov)
CCDB · book-fedorov — CoROJioscuaJI, CTpe;~- Rosa 1960
CCDB · CromoCat 2015 — Duckert-Henriod, M. M. (1991). In: G. Kamari, F. Felber & F. Garbari (Eds.), Mediterranean chromosome number reports, 7-25. Fl. Medit. 1: 229-236.
CCDB · CromoCat 2015 — Sokolovskaya, A. P. & O. S. Strelkova. (1960). Geographical distribution of the polyploid species of plants in the Eurasiatic arctic. Bot. Žurn. 45: 369-381.
2n 261×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Sorokin, S.N. (1993). Karyosistematic study of some members of the tribe Aveneae (Poaceae). Bot. Zurn. 78(4):36-47
2n 421×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Davlianidze, M. & Mosulisivili, M. (1984). Numerus chromosomatum de plantis nonnullis Gramineae florae Georgiae. Zametki Sist. Georgr. Rast. 40: 68-72.
2n 881×CCDB · Cave1956supp
CCDB · Cave1956supp — Tateoka 1954
n 04×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Provontova, N. S & Kazanovsky, S .G & Rudyka, E.G & Barkalov, V.Y & Seledets, V.P & Nechaev, V.A (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1790-1794
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Moritz, R. S., Lubogoschinsky, P. I. & Sergeyeva, A. S. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:892-894
CCDB · CromoCat 2015 — Korobkov, A. A., Kotseruba, V. V., Probatova, N. S. & Gnutikov, A. A.
Nina S. Probatova2* & Aleksandr A. Gnutikov1 (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:895-897
CCDB · CromoCat 2015 — Probatova, N.S.& Kazanovsky, S.G.& Rudyka, E.G. & Seledets, V.P. & Nechaev,V.A (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:899-902
n 143×CCDB · ipcn-api-dl · CCDB · Cave1963 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Duckert-Henriod, M. M. 1991. Mediterranean chromosome number reports 1 (7--25). Fl. Medit. 1: 229–236.
CCDB · Cave1963 — Sorsa 1962, 1963
CCDB · CromoCat 2015 — Duckert-Henriod, M. M. (1991). In: G. Kamari, F. Felber & F. Garbari (Eds.), Mediterranean chromosome number reports, 7-25. Fl. Medit. 1: 229-236.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type228 216 records
Wild obs. + sensor206 529
Museum / vouchered17 982
Cultivated / captive787
Other2 918
Origin
Native9 650
Introduced29
Range
Area of Occupancy AOO302 724 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy47% within 1 km
≤100 m 44 880≤1 km 36 288≤10 km 90 292>10 km 2 328
173 788 georeferenced · 32 741 without coordinates
Open the mapobservation + sensor206 529
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy34% within 1 km
≤100 m 846≤1 km 3 923≤10 km 7 969>10 km 1 283
14 021 georeferenced · 3 961 without coordinates
Open the institutions mapphysical evidence17 982
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy7% within 1 km
≤1 km 1≤10 km 2>10 km 11
14 georeferenced · 773 without coordinates
Open the mapnot free-living787
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions143 of 273 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 8 580 |
| Helsinki, FI | 939 |
| Olocation not on record | 656 |
| Moscow State Universitylocation not on record | 493 |
| LDlocation not on record | 403 |
| Trondheim, NO | 356 |
| Uppsala, SE | 342 |
| BFLlocation not on record | 322 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 262 |
| Oulu, FI | 247 |
| KMNlocation not on record | 196 |
| TROMlocation not on record | 162 |
| Tartu, EE | 153 |
| MeiseBGlocation not on record | 145 |
| Turku, FI | 138 |
| Salzburg, AT | 134 |
| Nagano City, JP | 119 |
| Madison, US | 117 |
| Bergen, NO | 117 |
| Oskarshamn, SE | 115 |
| Shinshu Universitylocation not on record | 101 |
| Chongqing Museumlocation not on record | 96 |
| Beijing, CN | 94 |
| SLU Artdatabankenlocation not on record | 90 |
| Adam Mickiewicz University in Poznańlocation not on record | 79 |
| Irkutsk State Universitylocation not on record | 77 |
| Sanda, JP | 77 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 71 |
| Yangling, CN | 70 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 70 |
| Ann Arbor, US | 67 |
| Odawara, JP | 64 |
| Chengdu, CN | 61 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 56 |
| Garðabær, IS | 56 |
| Québec, CA | 52 |
| BRNUlocation not on record | 51 |
| Görlitz, DE | 49 |
| Tallinn, EE | 48 |
| Guangzhou, CN | 48 |
| Kuopio, FI | 48 |
| Chengdu, CN | 46 |
| Akita Prefectural Museumlocation not on record | 44 |
| Tomioka, JP | 43 |
| Toyama, JP | 39 |
| Jyväskylä, FI | 37 |
| IFR-DNFlocation not on record | 36 |
| Provincia di Livornolocation not on record | 34 |
| Acadia Universitylocation not on record | 32 |
| Philadelphia, US | 32 |
| Barcelona, ES | 31 |
| JP | 31 |
| 29 | |
| Entomological Society of Latvialocation not on record | 28 |
| Dresden, DE | 27 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 27 |
| South Kensington, GB | 25 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 25 |
| Wlocation not on record | 23 |
| Berlin, DE | 23 |
| TUR-Alocation not on record | 22 |
| KIRMlocation not on record | 22 |
| Uniwersytet Jagiellońskilocation not on record | 22 |
| Vitoria, ES | 22 |
| CJBGlocation not on record | 21 |
| Bern, CH | 21 |
| Iwate Prefectural Museumlocation not on record | 20 |
| Tsukuba, JP | 20 |
| DBF-NHMDlocation not on record | 19 |
| Nagatoro-machi, Chichibu-gun, JP | 18 |
| Green Bay, US | 17 |
| BDBClocation not on record | 17 |
| Toronto, CA | 17 |
| BSBIlocation not on record | 16 |
| BIO-UNIPIlocation not on record | 16 |
| UniKSlocation not on record | 15 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 15 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 15 |
| Kandalaksha State Nature Reservelocation not on record | 15 |
| Tampa, US | 15 |
| MAlocation not on record | 14 |
| KR | 14 |
| Mlocation not on record | 14 |
| València, ES | 14 |
| ENTClocation not on record | 14 |
| GJOlocation not on record | 13 |
| Omachi Alpine Museumlocation not on record | 13 |
| Porrentruy, CH | 13 |
| Chiba, JP | 13 |
| SZUlocation not on record | 12 |
| Sendai, JP | 12 |
| Fukushima Universitylocation not on record | 11 |
| Kyoto Universitylocation not on record | 11 |
| Bando, JP | 11 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 11 |
| Stockholm, SE | 10 |
| Philadelphia, US | 10 |
| Salamanca, ES | 10 |
| Museo Entomologico de Leonlocation not on record | 10 |
| Bronx, US | 10 |
| University of Alberta Museumslocation not on record | 9 |
| SIHUlocation not on record | 9 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 9 |
| Montréal, CA | 9 |
| 东北师范大学自然博物馆location not on record | 9 |
| CICYTEXlocation not on record | 9 |
| Natural History Museum Rotterdamlocation not on record | 8 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 8 |
| Winterthur, CH | 8 |
| Wuhan, CN | 8 |
| Frankfurt am Main | 8 |
| Auckland, NZ | 8 |
| Rovaniemi, FI | 8 |
| BClocation not on record | 8 |
| Tilburg, NL | 8 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 8 |
| Xian, CN | 8 |
| GZUlocation not on record | 8 |
| Nanjing, CN | 7 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 7 |
| University of Stellenboschlocation not on record | 7 |
| McWane Science Centerlocation not on record | 7 |
| Otaru, JP | 7 |
| Université Lavallocation not on record | 7 |
| Servico de Microbiologia e Imunologialocation not on record | 7 |
| Porvoo, FI | 7 |
| Uniwersytet Warszawskilocation not on record | 7 |
| Glarus, CH | 7 |
| Chapel Hill, US | 6 |
| Seoul, KR | 6 |
| Pamplona, ES | 6 |
| Bangkok, TH | 6 |
| Zürich, CH | 6 |
| Karlsruhe, DE | 6 |
| Ypsilanti, US | 6 |
| Maryland Department of Natural Resourceslocation not on record | 6 |
| J.F.Oberlin Universitylocation not on record | 6 |
| Kunming, CN | 6 |
| Zhengzhou, CN | 6 |
| Durham, US | 6 |
| Saint Louis, US | 5 |
| Kushiro City Museumlocation not on record | 5 |
| Osaka, JP | 5 |
| Vancouver, CA | 5 |
| Christchurch, NZ | 5 |
| Uniwersytet Śląski w Katowicachlocation not on record | 5 |
| New Haven, US | 5 |
| Tromso University Museumlocation not on record | 5 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 5 |
| Paris, FR | 5 |
| Taipei, TW | 5 |
| Hobart, AU | 4 |
| Xining, CN | 4 |
| Obihiro Centennial City Museumlocation not on record | 4 |
| St. Paul, US | 4 |
| nbflocation not on record | 4 |
| Bourges, FR | 4 |
| Zürich, CH | 4 |
| WTUlocation not on record | 4 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 4 |
| Frauenfeld, CH | 4 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 4 |
| Forssa, FI | 4 |
| Kochi, JP | 4 |
| Uniwersytet w Białymstokulocation not on record | 3 |
| Dover, US | 3 |
| Royal Botanical Gardenslocation not on record | 3 |
| PRClocation not on record | 3 |
| Awka, NG | 3 |
| Logan, US | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Changsha, CN | 3 |
| International Salmonella Centre (W.H.O.)location not on record | 3 |
| Hangzhou, CN | 3 |
| Williamsburg, US | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Alicante, ES | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Taipei, TW | 3 |
| GMBAlocation not on record | 3 |
| Madrid, ES | 3 |
| WNNUlocation not on record | 3 |
| Hamilton, US | 3 |
| Central China Normal Universitylocation not on record | 3 |
| UGentlocation not on record | 3 |
| Namur, BE | 3 |
| Nijmegen, NL | 3 |
| College Park, US | 2 |
| DNSMlocation not on record | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Oswego, US | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| Granada, ES | 2 |
| Herb. BBGlocation not on record | 2 |
| Wuhan, CN | 2 |
| Dhaka, BD | 2 |
| Ischia Marine Centrelocation not on record | 2 |
| LfUlocation not on record | 2 |
| Nishihara, JP | 2 |
| ASUlocation not on record | 2 |
| Sion, CH | 2 |
| Xiamen, CN | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Moscow, US | 2 |
| Beijing, CN | 2 |
| Shenyang Agricultural Universitylocation not on record | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Tula State Universitylocation not on record | 2 |
| Dekalb, US | 2 |
| Korea National Arboretumlocation not on record | 2 |
| DMZ botanic gardenlocation not on record | 2 |
| Nishihara, JP | 1 |
| ULBF-AGRlocation not on record | 1 |
| Wuzhou, CN | 1 |
| Kew, GB | 1 |
| FLADlocation not on record | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| CASlocation not on record | 1 |
| Chengdu, CN | 1 |
| Millersville, US | 1 |
| nlocation not on record | 1 |
| Urumqi, CN | 1 |
| Coimbra, PT | 1 |
| Lanzhou, CN | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Staten Island, US | 1 |
| Riverside, US | 1 |
| Tokushima, JP | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| IPE-CSIClocation not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Burlington, US | 1 |
| Sapporo, JP | 1 |
| Guilin, CN | 1 |
| Lausanne, CH | 1 |
| Gijón, ES | 1 |
| H-Wolflocation not on record | 1 |
| Badajoz, ES | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Boise, US | 1 |
| Chicago, US | 1 |
| Davenport, US | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Decorah, US | 1 |
| Fairfax, US | 1 |
| NSMKlocation not on record | 1 |
| Tulane Universitylocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| *unvoucheredlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Fort Worth, US | 1 |
| Brussel, BE | 1 |
| Shanghai, CN | 1 |
| Chongqing, CN | 1 |
| Knoxville, US | 1 |
| Göteborg, SE | 1 |
| Mohonk Preservelocation not on record | 1 |
| Peking Universitylocation not on record | 1 |
| Sevilla, ES | 1 |
| Podgorica, ME | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| IWEP FEB RASlocation not on record | 1 |
| Mississippi State, US | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| ifplocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
273 institutions · 17 220 of 17 982 vouchered records shown · 594 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA140 detections
Where the DNA of Milium effusum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found140
Studies independent surveys2
Countries10
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 140 detections have coordinates
Open the map10 countries0
Northern temperate standin semi natural woodland
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.7 °C 8.70–18.2
Seasonal swing summer↔winter22.9 °C
Max temp (day)13.9 °C 10.3–21.2
Min temp (night)8.00 °C 5.20–14.2
Precipitation93.3 mm/mo 68.1–158
Air humidity63.4 % 59.3–65.1
Moisture balance24.2 mm/mo -43.6–65.8
Vapour deficit501 Pa 400–850
Wind speed3.30 m/s 2.10–4.80
Cloud cover60.0 % 35.9–68.3
CHELSA 1981–2010, ~9 km grid, at location & month of 132 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.