Mila caespitosa — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Mila

At a glance

Occurrence records84

Data sources8

Biological traits2

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Mila caespitosa's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility84 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF84 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Mila caespitosa is a species of cacti (family Cactaceae) and the only species of the genus Mila. Its generic name is an anagram of Lima, Peru. The genus was first thought to comprise 13 species, until recent studies suggest they form one very variable species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formsucculent subshrub

Habitat & environment1

Climatedesert or dry shrubland

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mila caespitosa has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences3

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSMW441831.1 ↗594 bp

ACGT

TCGAAACCTGCCCAGCAGAAAGACCCGCGAACACGTTTGCCTCAGCATGCGGGGCGGGGTGCCTCGGCGCCCTCCCCGCGCCGGGGGGCA …

Mila caespitosa isolate 011 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK2ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type84 records

Wild obs. + sensor65

Museum / vouchered19

Range

Area of Occupancy AOO300 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 65

65 georeferenced

Open the mapobservation + sensor65

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 1≤10 km 2>10 km 1

4 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Phoenix, US	9
Austin, US	4
Bronx, US	3
ASUlocation not on record	2
Saint Louis, US	1

5 institutions · 19 of 19 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Mila caespitosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.