Mikrogeophagus ramirezi

(Myers & Harry, 1948) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Cichlidae/Mikrogeophagus

At a glance

Occurrence records457

Data sources8

Biological traits5

DNA specimens19

eDNA detections20

Sources8 archives

Databases and archives Mikrogeophagus ramirezi's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility457 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF457 records

Environmental DNA1 datasets · 3 countries20 detections

DNA & barcodingBOLD19 specimens

01Narrative

The blue ram, Mikrogeophagus ramirezi, is a species of freshwater fish endemic to the Orinoco River basin, in the savannahs of Venezuela and Colombia in South America. The species has been examined in studies on fish behaviourRobins CR, Bailey RM, Bond CE, Brooker JR, Lachner EA, Lea RN, Scott WB (1991) World fishes important to North Americans. Exclusive of species from the continental waters of the United States and Canada. Am. Fish. Soc. Spec. Publ. 21: p. 243. and is a popular aquarium fish, traded under a variety of common names, including ram, blue ram, German blue ram, Asian ram, butterfly cichlid, Ramirez's dwarf cichlid, dwarf butterfly cichlid and Ramirezi.Linke H, Staeck L (1994) American cichlids I: Dwarf Cichlids. A handbook for their identification, care and breeding. Tetra Press. Germany.Axelrod HR, Vorderwinkler W (1995) Encyclopedia of tropical fishes 30th Edn. TFH Publications, USA. The species is a member of the family Cichlidae and subfamily Geophaginae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length3.4 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceof no interest

Other traits1

Vulnerability10

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mikrogeophagus ramirezi has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

eDNA detections20

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.09%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

484Amostly conserved

CCTCTATCTGGTATTTGGTGCTTGAGCTGGAATAGTAGGCACTGCATTAAGCCTAATAATCCGAGCAGAACTAAGCCAGCCCGGCTCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Geophagus itapicuruensissame family12.1%Geophagus santosisame family12.9%Geophagus iporangensissame family13.2%Geophagus multiocellussame family13.5%Geophagus brasiliensissame family13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_031439 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

07Deep time~32.8 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin32.8 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type457 records

Wild obs. + sensor53

Museum / vouchered404

Origin

Native4

Range

Area of Occupancy AOO1 024 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 53 records without

Open the mapobservation + sensor53

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 2≤1 km 13≤10 km 17

32 georeferenced · 372 without coordinates

Open the institutions mapphysical evidence404

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto de Biodiversidad de Venezuela - INBIOlocation not on record	187
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	56
University of Nebraskalocation not on record	28
Universidad de los Llanos (UniLlanos)location not on record	26
Pontificia Universidad Javeriana (PUJ)location not on record	24
Universidad del Tolima (UT)location not on record	24
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	16
Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record	8
Museu de Zoologia da Universidade de Sao Paulolocation not on record	6
Champaign, US	6
Montgomery, US	5
Toronto, CA	5
Stockholm, SE	4
Texas Cooperative Wildlife Collectionlocation not on record	3
PUC-RSlocation not on record	2
UEMlocation not on record	1
UFRRJlocation not on record	1
Ann Arbor, US	1
Chicago, US	1

19 institutions · 404 of 404 vouchered records shown

09Environmental DNA20 detections

Where the DNA of Mikrogeophagus ramirezi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.1 °C 16.1–20.1

Seasonal swing summer↔winter41.0 °C

Max temp (day)19.6 °C 19.6–23.6

Min temp (night)13.6 °C 13.6–16.0

Precipitation122 mm/mo 122–328

Air humidity57.4 % 57.4–65.8

Moisture balance-26.1 mm/mo -26.1–229

Vapour deficit779 Pa 751–854

Wind speed5.50 m/s 0.9–5.50

Cloud cover43.0 % 43.0–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)