Mikiola fagi

(Hartig, 1839) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Cecidomyiidae/Mikiola

At a glance

Occurrence records16 769

Data sources7

Biological traits0

DNA specimens13

eDNA detections18

Sources7 archives

Databases and archives Mikiola fagi's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility16 769 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF16 769 records

Environmental DNA2 datasets · 6 countries18 detections

DNA & barcodingBOLD13 specimens

01Narrative

Mikiola fagi, the beech gall midge is a gall-causing fly in the family Cecidomyiidae. This species was first described by Theodor Hartig in 1839.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mikiola fagi has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes1

eDNA detections18

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

22Gmostly conserved

184Gmostly conserved

215Gmostly conserved

343Avariable

AACTCTTTATTTTATTTTCGGGATTTGAGCAGGAATAGTAGGAACATCATTAAGAATTTTAATTCGAATAGAATTAAGAAGAATTTCAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.16%

Haplotypes5

BIN1

Most divergent pair0.46%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pekinomyia syringaesame family10.1%Dasineura epilobiisame family10.6%Dasineura plicatrixsame family10.7%Rhopalomyia strumasame family11.1%Dasineura ulmariasame family11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type16 769 records

Wild obs. + sensor16 704

Museum / vouchered60

Cultivated / captive4

Other1

Range

Area of Occupancy AOO31 852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 5 912≤1 km 2 326≤10 km 5 524>10 km 134

13 896 georeferenced · 2 808 without coordinates

Open the mapobservation + sensor16 704

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy98% within 1 km

≤100 m 1≤1 km 44≤10 km 1

46 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence60

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Historic Englandlocation not on record	4
Stockholm, SE	4
AF, AKlocation not on record	2
SLU Artdatabankenlocation not on record	2
-location not on record	1
Brown Universitylocation not on record	1
Nijmegen, NL	1
LPMFlocation not on record	1
NHMOlocation not on record	1
Ugentlocation not on record	1

10 institutions · 18 of 60 vouchered records shown · 42 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA18 detections

Where the DNA of Mikiola fagi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys2

Countries6

Verifiable raw sequence linked5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map6 countries0

1.4. Temperate Forest|1. Forest & WoodlandForestGalled leaves of Fagus sylvatica

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median4.50 °C 0.8–16.3

Seasonal swing summer↔winter17.1 °C

Max temp (day)8.50 °C 3.30–20.0

Min temp (night)0 °C -1.90–12.2

Precipitation53.6 mm/mo 39.3–90.2

Air humidity60.4 % 59.3–67.3

Moisture balance3.50 mm/mo -39.3–24.8

Vapour deficit342 Pa 216–736

Wind speed3.60 m/s 3.20–5.00

Cloud cover47.1 % 39.0–50.9

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mikiola fagi

At a glance

Sources7 archives

At a glance

Record type16 769 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions2 of 10 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type16 769 records