Mikania micrantha
Kunth · speciesAt a glance
Occurrence records14 836
Data sources13
Biological traits32
DNA specimens12
eDNA detections124
Sources13 archives
Databases and archives Mikania micrantha's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility14 836 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI124 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics12 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources32 traits
Chemical compositionLOTUS · NPASS53 compounds
Occurrence & distributionGBIF14 836 records
Environmental DNA3 datasets · 7 countries124 detections
DNA & barcodingBOLD · NCBI12 specimens
Genome at a glanceCCDB · GoaT · NCBI≈1.8 Gbp
01Narrative
Mikania micrantha, aussi appelée liane américaine, est une espèce de plantes à fleurs dicotylédones de la famille des Asteraceae, tribu des Eupatorieae, originaire des régions tropicales d'Amérique centrale et d'Amérique du Sud. L'espèce fait partie des 100 pires espèces envahissantes selon l'UICN.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPAusTraitsGIFTTRY
Size & morphology8
Fruit length2 mm
Leaf length80 mm
Leaf width55 mm
Petiole length4.5 cm
Plant height6 m
Seed mass0.09 mg
Seed mass max0.09 mg
Seed mass min0.09 mg
Life cycle & reproduction5
Deciduousnessevergreen
Dispersal typewind
Flowering timennnnnyynnnnn
Life formscrambling subshrub
Life spanperennial
Diet & foraging1
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatewet tropical
Climberobligatory
Elevation max2 900 m
Elevation mean500 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: climber_herbaceous · TRY: Vine
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Campo Limpo, Cerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta Estacional Decidual, Floresta Estacional Perenifólia, Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial), Floresta Omb
Leaf compoundnesssimple
Leaf shapedeltate ovate
Succulenceno
Woodinessnon-woody
Physiology & chemistry3
Leaf n33.6 mg/g
Nitrogen fixingnon_nitrogen_fixer
Specific leaf area (SLA)46.67 mm²/mg
03Chemical composition53 compounds
Compounds documented for Mikania micrantha across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Germacrane sesquiterpenoids31
Guaiane sesquiterpenoids6
Flavanones4
Flavonols3
Ursane and Taraxastane triterpenoids3
Documented compounds53 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-Alpinetin | present | LOTUS | |
| (-)-Kaur-16-en-19-oic acid | present | LOTUS | |
| (1aS,7R,7aR,10aS,11aS)-1a,2,3,7a,8,10a,11,11a-Octahydro-11a-methyl-8-methylene-5H-7,4-methenofuro[3,2-c]oxireno[f]oxacycloundecin-5,9(7H)-dione | present | LOTUS | |
| (1R,2R,3R,6S,8S,10R)-3,8-dimethyl-5,9,15-trioxatetracyclo[11.2.1.02,6.08,10]hexadec-13(16)-ene-4,14-dione | present | LOTUS | |
| (1R,2R,3R,6S,8S,10R,11R,12R)-11,12-dihydroxy-3,8-dimethyl-5,9,15-trioxatetracyclo[11.2.1.02,6.08,10]hexadec-13(16)-ene-4,14-dione | present | LOTUS | |
| (1R,2R,3R,6S,8S,10R,12R)-12-hydroxy-3,8-dimethyl-5,9,15-trioxatetracyclo[11.2.1.02,6.08,10]hexadec-13(16)-ene-4,14-dione | present | LOTUS | |
| (1R,2R,3R,6S,8S,10S)-3,8-dimethyl-5,9,15-trioxatetracyclo[11.2.1.02,6.08,10]hexadec-13(16)-ene-4,14-dione | present | LOTUS | |
| (1R,2R,6S,8S,10S,11Z)-8-methyl-3-methylidene-5,9,15-trioxatetracyclo[11.2.1.02,6.08,10]hexadeca-11,13(16)-diene-4,14-dione | present | LOTUS | |
| (1R,9S,11S,15R,16S)-9-methyl-14-methylidene-2,6,12-trioxatetracyclo[7.6.1.04,16.011,15]hexadeca-4,7-diene-3,13-dione | present | LOTUS | |
| (1S,2S,3R,6S,8S,10R,12R)-12-hydroxy-3,8-dimethyl-5,9,15-trioxatetracyclo[11.2.1.02,6.08,10]hexadec-13(16)-ene-4,14-dione | present | LOTUS |
05DNA & barcoding12 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mikania micrantha has left across the world's sequence archives.
At a glance
DNA specimens12
Marker genes4
GenBank sequences10
eDNA detections124
Countries7
The DNA barcodea real sequence read deposited for this species
TTTGAACGCAAGTTGCGCCCGAGGCCACTTGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCATGTCGCCCAAATCAAACTTACCTTA …
Mikania micrantha isolate MU/BOT/001686 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL1★ITS9★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Mikania micrantha carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size≈1 790 643 622 bp assembly estimate
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Mikania micrantha1.79 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 72 n = 36
Ploidydiploid inferred
Chromosome records72–722n range72median72mode4records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 724×CCDB · croinout · CCDB · ipcn-api-dl
CCDB · croinout — Ruas, P. M. & Ruas, C. F. 1987
CCDB · croinout — Ruas, P. M., Ruas, C. F. & Matzenbacher, N. I. 1986
CCDB · ipcn-api-dl — Ruas, P. M. & C. F. Ruas. 1987. Karyotypes and chromosome morphology in the genus Mikania (Compositae) I. Cytologia 52: 551–558.
CCDB · ipcn-api-dl — Rusa. 1986. Estudo citogenético de seis espécies do género Mikania (Compositae) I. Ci. & Cult. (Sao Paulo) 38: 851–852.
n 196×CCDB · croinout · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71
CCDB · croinout — Waisman, C. E., Rozenblum, E. & Hunziker, J. H. 1984
CCDB · croinout — Powell, A. M. & King, R. M. 1969
CCDB · croinout — King, R. M., Kyhos, D. W., Powell, A. M., Raven, P. H. & Robinson, H. 1976
CCDB · ipcn-api-dl — Waisman, C. E., E. Rozenblum & J. H. Hunziker. 1984. Estudios cariológicos en Compositae I. Darwiniana 25: 217–226.
CCDB · book-ipcn67-71 — POWELL, A.M., & R.M. KING. 1969. Chromosome numbers in the Compositae: Colombian species. Amer. J. Bot. 56: 116-121.
n 173×CCDB · croinout · CCDB · ipcn-api-dl
CCDB · croinout — Turner, B. L., Bacon, J., Urbatsh, L. & Simpson, B. 1979
CCDB · croinout — King, R. M., Kyhos, D. W., Powell, A. M., Raven, P. H. & Robinson, H. 1976
CCDB · ipcn-api-dl — Turner, B. L., J. BACON, L. Urbatsh & B. Simpson. 1979. Chromosome numbers in South American Compositae. Amer. J. Bot. 66: 173–178.
n 182×CCDB · croinout · CCDB · ipcn-api-dl
CCDB · croinout — Jansen, R. K., Stuessy, T. F., Daz-Piedrahta, S. & Funk, V. A. 1984
CCDB · ipcn-api-dl — Jansen, R. K., T. F. Stuessy, S. Díaz-Piedrahíta & V. A. Funk. 1984. Recuentos cromosómicos en Compositae de Colombia. Caldasia 14(66): 7–20.
n 201×CCDB · croinout
CCDB · croinout — Powell, A. M. & King, R. M. 1969
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness94.6% BUSCO
08Occurrence & distribution
Record type14 836 records
Wild obs. + sensor10 287
Museum / vouchered4 257
Other292
Origin
Native726
Introduced25
Range
Area of Occupancy AOO26 892 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy94% within 1 km
≤100 m 5 947≤1 km 705≤10 km 266>10 km 127
7 045 georeferenced · 3 242 without coordinates
Open the mapobservation + sensor10 287
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy64% within 1 km
≤100 m 369≤1 km 71≤10 km 165>10 km 79
684 georeferenced · 3 573 without coordinates
Open the institutions mapphysical evidence4 257
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions113 of 256 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 763 |
| University of Stellenboschlocation not on record | 252 |
| Bronx, US | 193 |
| TAIElocation not on record | 169 |
| Durango, MX | 165 |
| National Biodiversity Institute, Costa Ricalocation not on record | 124 |
| Mexico City, MX | 115 |
| Blumenau, BR | 94 |
| BAYLUlocation not on record | 85 |
| Austin, US | 82 |
| Kew, GB | 76 |
| León, NI | 53 |
| San Isidro, AR | 51 |
| Universidad Nacional de Colombia (UNAL)location not on record | 43 |
| UFMSlocation not on record | 41 |
| Universidad de Antioquia (UdeA)location not on record | 39 |
| Canberra, AU | 36 |
| Brisbane, AU | 35 |
| Universidade Federale do Rio Grande do Sullocation not on record | 35 |
| JBRJlocation not on record | 33 |
| UTFPR-CPlocation not on record | 32 |
| Antiguo Cuscatlán, SV | 31 |
| Campo Mourão, BR | 30 |
| Porto Alegre, BR | 29 |
| UNICAMPlocation not on record | 28 |
| Paleontological Collectionlocation not on record | 28 |
| Stockholm, SE | 27 |
| Berlin, DE | 26 |
| Córdoba, AR | 26 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 24 |
| Corrientes, AR | 23 |
| Ivano-Frankivsk, UA | 23 |
| Londrina, BR | 23 |
| INBIOlocation not on record | 23 |
| Xiamen, CN | 23 |
| Campo Grande, BR | 22 |
| Kathmandu, NP | 22 |
| UnBlocation not on record | 21 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 21 |
| Chapingo, MX | 19 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 19 |
| Wuzhou, CN | 19 |
| PUC-RSlocation not on record | 19 |
| Maringá, BR | 18 |
| Universidad de Nariño (UdeNar)location not on record | 18 |
| ESALQlocation not on record | 17 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 16 |
| Mérida, MX | 16 |
| CASlocation not on record | 15 |
| Universiti Sains Malaysialocation not on record | 14 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 14 |
| Istituto Agrario Castelnuovolocation not on record | 13 |
| Aarhus, DK | 13 |
| USP-IBlocation not on record | 12 |
| FUVATESlocation not on record | 12 |
| HUT Culture Collectionlocation not on record | 12 |
| Santa Cruz de la Sierra, BO | 12 |
| Pelotas, BR | 12 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 12 |
| St. Augustine, TT | 12 |
| ASUlocation not on record | 11 |
| UNESP-RClocation not on record | 11 |
| Palmerston, AU | 11 |
| UFMGlocation not on record | 11 |
| UNESClocation not on record | 10 |
| Austin, US | 10 |
| Cenargenlocation not on record | 10 |
| Smithfield, AU | 10 |
| Taipei, TW | 10 |
| INMAlocation not on record | 10 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 10 |
| Loja, EC | 9 |
| Lake Charles, US | 9 |
| Universidad Nacional de Asunciónlocation not on record | 9 |
| Tuxtla Gutiérrez, MX | 9 |
| Tapachula, MX | 9 |
| Uberlândia, BR | 9 |
| Tampa, US | 9 |
| San José, CR | 9 |
| Laboratory of Palaeontologylocation not on record | 9 |
| Anton de Kom University of Surinamelocation not on record | 9 |
| UEMlocation not on record | 8 |
| Chicago, US | 8 |
| Cusco, PE | 8 |
| Chongqing Museumlocation not on record | 8 |
| Brasília, BR | 8 |
| Universidade de São Paulolocation not on record | 8 |
| Altos de Pipe, VE | 8 |
| Foz do Iguaçu, BR | 8 |
| Castelar, AR | 8 |
| UFPRlocation not on record | 7 |
| Criciúma, BR | 7 |
| UFSClocation not on record | 7 |
| CEPLAClocation not on record | 7 |
| Durham, US | 7 |
| MEXUlocation not on record | 7 |
| Ural Federal University "B. N. Yeltsin"location not on record | 7 |
| TNMlocation not on record | 7 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 7 |
| Iquitos, PE | 6 |
| La Paz, BO | 6 |
| Cuiabá, BR | 6 |
| UFBAlocation not on record | 6 |
| IPA/SPlocation not on record | 6 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 6 |
| UNESP-FCAlocation not on record | 6 |
| Riverside, US | 6 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 6 |
| Santa Teresa, BR | 6 |
| Paris, FR | 5 |
| Guatemala City, GT | 5 |
| Lima, PE | 5 |
| Kensington, AU | 5 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 5 |
| QCNElocation not on record | 5 |
| Taipei, TW | 4 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 4 |
| Universidade Federal do Maranhãolocation not on record | 4 |
| Cibinong Science Center, Herbarium Bogorienselocation not on record | 4 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 4 |
| Honolulu, US | 4 |
| Tuxtla Gutiérrez, MX | 4 |
| UNIVILLElocation not on record | 4 |
| Montréal, CA | 4 |
| UTPLlocation not on record | 4 |
| South Kensington, GB | 4 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 4 |
| UFPElocation not on record | 4 |
| CJBGlocation not on record | 4 |
| UTFPR-DVlocation not on record | 4 |
| Universidade Federal de Santa Catarinalocation not on record | 4 |
| Brasília, BR | 4 |
| Laboratorio de Ictiologialocation not on record | 4 |
| Université de Bordeauxlocation not on record | 3 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 3 |
| Pontifícia Universidade Católica do Paranálocation not on record | 3 |
| Universidad de Caldas (UCaldas)location not on record | 3 |
| Université de Strasbourglocation not on record | 3 |
| MeiseBGlocation not on record | 3 |
| Odawara, JP | 3 |
| Auckland, NZ | 3 |
| Jena Microbial Resource Collectionlocation not on record | 3 |
| EL PASO, US | 3 |
| Guangzhou, CN | 3 |
| Seychelles National Herbariumlocation not on record | 3 |
| UFSCarlocation not on record | 3 |
| San Francisco de Campeche, MX | 3 |
| HUAlocation not on record | 3 |
| Universidade Federal de Pelotaslocation not on record | 3 |
| Fundación Estación Biológica Guayacanallocation not on record | 3 |
| Cochabamba, BO | 3 |
| Teresina, BR | 3 |
| Cascavel, BR | 3 |
| US | 3 |
| UTFPR-SLlocation not on record | 2 |
| Plocation not on record | 2 |
| Ann Arbor, US | 2 |
| Museo de Historia Natural de El Salvadorlocation not on record | 2 |
| Glocation not on record | 2 |
| Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record | 2 |
| Bogotá, D.C., CO | 2 |
| UFRRJlocation not on record | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Juriquilla, MX | 2 |
| BISHlocation not on record | 2 |
| Madison, US | 2 |
| Toronto, CA | 2 |
| LGlocation not on record | 2 |
| Instituto de Investigaciones Botánicas y Zoológicas - Prof. Rafael M. Moscoso, Universidad Autónoma de Santo Domingolocation not on record | 2 |
| Bloomington, US | 2 |
| Ciudad de México, MX | 2 |
| OTSlocation not on record | 2 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 2 |
| LDlocation not on record | 2 |
| UNESP-IBILCElocation not on record | 2 |
| Salta, AR | 2 |
| Fortaleza, BR | 2 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 2 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 2 |
| Universidade Tecnológica Federal do Paranálocation not on record | 2 |
| Davis, US | 2 |
| Managua, NI | 2 |
| Calabar, NG | 2 |
| Riobamba, EC | 2 |
| Mexico City, MX | 2 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 2 |
| Fredericksburg, US | 2 |
| Burlington, US | 2 |
| Universidad Nacional Agrarialocation not on record | 2 |
| UNISANTAlocation not on record | 2 |
| Giardini Botanici Hanburylocation not on record | 1 |
| Autlán de Navarro, MX | 1 |
| Instituto Nacional de Pesquisas da Amazonialocation not on record | 1 |
| Jardín Botánico Nacional Dr. Rafael M. Moscosolocation not on record | 1 |
| Masindi, UG | 1 |
| Durham, US | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| CUVClocation not on record | 1 |
| Oregon State Universitylocation not on record | 1 |
| GB | 1 |
| ACT-Slocation not on record | 1 |
| CPATSAlocation not on record | 1 |
| Cambridge, US | 1 |
| Nishihara, JP | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| UEMAlocation not on record | 1 |
| IAPlocation not on record | 1 |
| Fukushima Universitylocation not on record | 1 |
| Dekalb, US | 1 |
| Moscow State Universitylocation not on record | 1 |
| Quito, EC | 1 |
| Kunming, CN | 1 |
| Wlocation not on record | 1 |
| Provo, US | 1 |
| UFABClocation not on record | 1 |
| Universidade Paulistalocation not on record | 1 |
| Seropédica, BR | 1 |
| València, ES | 1 |
| Herbario de la Universidad Técnica del Nortelocation not on record | 1 |
| UNICENTRO-IRATIlocation not on record | 1 |
| Universidad Tecnológica del Chocólocation not on record | 1 |
| Universidad de los Llanos (UniLlanos)location not on record | 1 |
| Universidad del Quindío (UniQuindío)location not on record | 1 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 1 |
| Ulocation not on record | 1 |
| Uppsala, SE | 1 |
| Clemson, US | 1 |
| BMlocation not on record | 1 |
| Sangmiung Universitylocation not on record | 1 |
| UDESC-CAVlocation not on record | 1 |
| Mérida, MX | 1 |
| San Luis Obispo, US | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| FPMZBlocation not on record | 1 |
| Museu Paraense Emílio Goeldilocation not on record | 1 |
| Phoenix, US | 1 |
| San Diego, US | 1 |
| Fort Worth, US | 1 |
| Edinburgh, GB | 1 |
| Universidade Federal do Vale do São Franciscolocation not on record | 1 |
| XALlocation not on record | 1 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 1 |
| Santiago de Cali, CO | 1 |
| Tuscaloosa, US | 1 |
| UNEMATlocation not on record | 1 |
| Universidade Federal de Sergipe (UFS)location not on record | 1 |
| UEPAlocation not on record | 1 |
| URCAlocation not on record | 1 |
| MAlocation not on record | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 1 |
| Universidad Nacional de Misiones- CONICETlocation not on record | 1 |
| Salvador, BR | 1 |
| University of Papua New Guinealocation not on record | 1 |
256 institutions · 3 982 of 4 257 vouchered records shown · 273 without an institution code
09Environmental DNA124 detections
Where the DNA of Mikania micrantha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found124
Studies independent surveys3
Countries7
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 124 detections have coordinates
Open the map7 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median23.6 °C 21.0–26.5
Seasonal swing summer↔winter5.90 °C
Max temp (day)29.4 °C 25.9–29.4
Min temp (night)19.2 °C 16.1–24.2
Precipitation47.9 mm/mo 47.9–196
Air humidity57.3 % 57.3–69.0
Moisture balance-106 mm/mo -106–54.1
Vapour deficit1,241 Pa 1,019–1,241
Wind speed3.30 m/s 1.90–4.00
Cloud cover30.5 % 30.5–50.1
CHELSA 1981–2010, ~9 km grid, at location & month of 120 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.