Microstoma floccosum

(Sacc.) Raitv. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Pezizomycetes/Pezizales/Sarcoscyphaceae/Microstoma

At a glance

Occurrence records660

Data sources8

Biological traits0

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Microstoma floccosum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility660 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF660 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Microstoma floccosum is een bekerzwam behorend tot de familie Sarcoscyphaceae. Hij is herkenbaar aan zijn diepe trechtervormige, scharlakenrode vruchtlichamen met witte haren aan de buitenkant. Hij komt voor in de Verenigde Staten en Azië, groeit het op gedeeltelijk begraven stokken en twijgen van eikenbomen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Microstoma floccosum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences10

eDNA detections2

Countries4

The DNA barcodea real sequence read deposited for this species

ITSAF394046.1 ↗624 bpMexico

ACGT

TTTCCGTTAGGTGAACCTGCGGAAGGATCATTAAAAACGTGCATCTCGTGGATGGCATTGAGGCGTCCCTCGGGGCGCCTGTCGCCACGC …

Microstoma floccosum isolate Micro45 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 25S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type660 records

Wild obs. + sensor554

Museum / vouchered106

Range

Area of Occupancy AOO2 036 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 198≤1 km 86≤10 km 72>10 km 62

418 georeferenced · 136 without coordinates

Open the mapobservation + sensor554

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 1≤1 km 12≤10 km 30>10 km 4

47 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence106

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Catholic University of Pekinglocation not on record	16
Chicago, US	13
Davis and Elkins Collegelocation not on record	12
Tomioka, JP	8
Champaign, US	5
Odawara, JP	5
ILLSlocation not on record	5
TENN-Flocation not on record	5
National Museum of Natural Sciencelocation not on record	4
Durham, US	3
St. Paul, US	3
Tartu, EE	3
FLASlocation not on record	3
National Institute of Biological Resourceslocation not on record	3
Osaka, JP	2
Université de Montréal Biodiversity Centrelocation not on record	2
Bando, JP	2
Ann Arbor, US	2
Pullman, US	2
Adam Mickiewicz University in Poznańlocation not on record	2
Nagatoro-machi, Chichibu-gun, JP	1
PHlocation not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
Blacksburg, US	1
Bronx, US	1

25 institutions · 105 of 106 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Microstoma floccosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C

Min temp (night)9.00 °C

Precipitation34.7 mm/mo

Air humidity50.9 %

Moisture balance-93.3 mm/mo

Vapour deficit884 Pa

Wind speed4.10 m/s

Cloud cover25.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)