Microsporum gallinae — The Life Data

Fungi/Ascomycota/Eurotiomycetes/Onygenales/Arthrodermataceae/Microsporum

At a glance

Occurrence records6

Data sources8

Biological traits0

DNA specimens13

eDNA detections9

Sources8 archives

Databases and archives Microsporum gallinae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility6 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF6 records

Environmental DNA3 datasets · 3 countries9 detections

DNA & barcodingBOLD · NCBI13 specimens

01Narrative

Microsporum gallinae is a fungus of the genus Microsporum that causes dermatophytosis, commonly known as ringworm. Chickens represent the host population of Microsporum gallinae but its opportunistic nature allows it to enter other populations of fowl, mice, squirrels, cats, dogs and monkeys. Human cases of M. gallinae are rare, and usually mild, non-life-threatening superficial infections.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Microsporum gallinae has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes4

GenBank sequences10

eDNA detections9

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMT703688.1 ↗534 bpThailand · 2015

ACGT

GATCATTAACGCGCAGGCCGACGTTGGCCCTCTCCCCGAGAAGGGGGGGGAACTCCGGCCACACGCCCATTCTTGTCTACCGACCCAGTT …

Lophophyton gallinae isolate VSMU3M internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10ITS1ITS25-8S

fungal barcodemarker

08Occurrence & distribution

Record type6 records

Museum / vouchered6

Range

Area of Occupancy AOO16 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the institutions mapphysical evidence6

10Collections & institutions

Institution	Specimens
Scientific Institute of Public Health, Brusselslocation not on record	2

1 institutions · 2 of 6 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Microsporum gallinae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys3

Countries3

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 16.8–21.3

Seasonal swing summer↔winter16.7 °C

Max temp (day)22.4 °C 22.3–26.0

Min temp (night)11.4 °C 10.5–15.8

Precipitation45.3 mm/mo 8.80–97.1

Air humidity51.6 % 40.2–56.2

Moisture balance-83.2 mm/mo -127–-24.1

Vapour deficit1,017 Pa 1,002–1,658

Wind speed3.50 m/s 2.40–3.90

Cloud cover24.0 % 21.9–29.2

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.