Microsporum audouinii

Gruby · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Onygenales/Arthrodermataceae/Microsporum

At a glance

Occurrence records10

Data sources10

Biological traits0

DNA specimens57

eDNA detections38

Sources10 archives

Databases and archives Microsporum audouinii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics57 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF10 records

Environmental DNA3 datasets · 8 countries38 detections

DNA & barcodingBOLD · NCBI57 specimens

Genome at a glanceGoaT · NCBI≈24 Mbp

01Narrative

Microsporum audouinii is an anthropophilic fungus in the genus Microsporum. It is a type of dermatophyte that colonizes keratinized tissues (primarily hair) causing infection. The fungus is characterized by its spindle-shaped macroconidia (7–30 × 35–160 μm), clavate microconidia (2.5–3.5 × 4–7 μm) as well as its pitted or spiny external walls.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding57 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Microsporum audouinii has left across the world's sequence archives.

At a glance

DNA specimens57

Marker genes4

GenBank sequences10

eDNA detections38

Countries9

The DNA barcodea real sequence read deposited for this species

ITSPV796090.1 ↗522 bpChina · 2024

ACGT

GGCCGCACGCCCATTCTTGTCTACTGACCCGGTTGCCTCGGCGGGCCGCGCCTGCTGTGCTACAGCGGCCGTTCGGGGGGGACGCCTGAG …

Microsporum audouinii isolate CBS545.93 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS25-8S

fungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Microsporum audouinii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈23 995 729 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Microsporum audouinii0.02 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type10 records

Museum / vouchered10

Range

Area of Occupancy AOO36 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the institutions mapphysical evidence10

10Collections & institutions

Institution	Specimens
Scientific Institute of Public Health, Brusselslocation not on record	7

1 institutions · 7 of 10 vouchered records shown

09Environmental DNA38 detections

Where the DNA of Microsporum audouinii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys3

Countries8

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map8 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.0 °C 19.4–25.9

Seasonal swing summer↔winter4.40 °C

Max temp (day)27.7 °C 24.3–30.7

Min temp (night)20.3 °C 14.0–21.5

Precipitation89.4 mm/mo 48.1–145

Air humidity55.8 % 54.0–68.7

Moisture balance-44.5 mm/mo -112–14.1

Vapour deficit1,142 Pa 909–1,452

Wind speed2.00 m/s 1.30–2.90

Cloud cover46.4 % 32.4–51.7

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)