Micromeria graeca

(L.) Benth. ex Rchb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Micromeria

At a glance

Occurrence records1 959

Data sources10

Biological traits14

DNA specimens5

eDNA detections2

Sources10 archives

Databases and archives Micromeria graeca's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 959 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS8 compounds

Occurrence & distributionGBIF1 959 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 60

01Narrative

Micromeria graeca is a plant species in the family Lamiaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.142 mg

Seed mass max0.24 mg

Seed mass min0.07 mg

Life cycle & reproduction3

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition8 compounds

Compounds documented for Micromeria graeca across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavones5

Flavanones3

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(R)-naringenin	present	LOTUS
(S)-Naringenin	present	LOTUS
Acacetin	present	LOTUS
Apigenin	present	LOTUS
Chrysoeriol	present	LOTUS
Diosmetin	present	LOTUS
Luteolin 7-diglucoside	present	LOTUS
Poncirin	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Micromeria graeca has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes1

GenBank sequences2

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

matKAY840157.1 ↗2 429 bpSpain

ACGT

GGATGAAGTGACGGATTCGTCCATACCATTGGTAAACTTTGGAAGACCGCGACTGACCCTGAAAGGGAATAAATGGAAAAAATAGCATGT …

Micromeria graeca trnK gene, intron; and maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Micromeria graeca carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Ploidypolyploid inferred

Chromosome records20–602n range60median60mode14records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 609×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015

CCDB · iber-fl — Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Luque, T. & Z. Daz Lifante.Bocconea1: 303-364(1991).

CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 582-590. Morales Valverde, R.Anales Jard. Bot. Madrid47(1): 193-198(1990).

CCDB · ipcn-api-dl — Luque, T. & Z. D. Lifante. 1991. Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303–364.

CCDB · ipcn-api-dl — Morales, R. 1990. Números cromosomáticos de plantas occidentales, 582--590. Anales Jard. Bot. Madrid 47: 193–198.

CCDB · CromoCat 2015 — Morales Valverde, R. (1990a). Números cromosomáticos de plantas occidentales, 582-590. Anales Jard. Bot. Madrid 47(1): 193-198.

CCDB · CromoCat 2015 — Luque, T. & Díaz Lifante, Z. (1991). Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303-364.

CCDB · CromoCat 2015 — Morales, R. (1990). Números cromosomáticos de plantas occidentales, 582-590. Anales Jard. Bot. Madrid 47:193-198

2n 205×CCDB · iber-fl · CCDB · fl-europaea · CCDB · book-ipcn67-71 +1

CCDB · iber-fl — Chromosome numbers in Iberian angiosperms. Bjorkqvist, I. & al.Bot. Not.122: 271-283(1969).

CCDB · fl-europaea — BjOrkqvist et al.

CCDB · book-ipcn67-71 — BJ.ORKQVIST, I . , R. VON BOTHMER, O. NILSSON: & B. NORDENSTAM. 1969. Chromosome numbers in Iberian Angiosperms. Bot. Notiser 122: 271-28;

CCDB · CromoCat 2015 — Björkqvist, I., von Bothmer, R., Nilsson, O. & Nordenstam, B. (1969). Chromosome numbers in Iberian angiosperms. Bot. Not. 122: 271-283.

CCDB · CromoCat 2015 — Kerguélen, M. (1998). Index synonymique de la Flore de France INRA-MNHN Dijon

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 959 records

Wild obs. + sensor1 380

Museum / vouchered547

Cultivated / captive1

Other31

Origin

Native349

Range

Area of Occupancy AOO5 168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 305≤1 km 425≤10 km 412>10 km 30

1 172 georeferenced · 208 without coordinates

Open the mapobservation + sensor1 380

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 14≤1 km 129≤10 km 114

257 georeferenced · 290 without coordinates

Open the institutions mapphysical evidence547

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	89
València, ES	60
CICYTEXlocation not on record	41
Córdoba, ES	32
LDlocation not on record	29
MAlocation not on record	28
BClocation not on record	28
College of the Atlantic, Museumlocation not on record	28
BIO-UNIPIlocation not on record	25
Barcelona, ES	25
Institut und Museum fuer Geologie und Palaeontologielocation not on record	23
UIBlocation not on record	18
Wlocation not on record	18
Badajoz, ES	15
Alicante, ES	11
Granada, ES	11
Salamanca, ES	9
Phyletisches Museum Jenalocation not on record	7
Adam Mickiewicz University in Poznańlocation not on record	4
BRNUlocation not on record	4
Frankfurt am Main	4
Paris, FR	3
Xiamen, CN	3
Museo Achille Folettolocation not on record	2
Entomological Society of Latvialocation not on record	2
Jaén, ES	2
Museo della Bonifica di San Donà di Piavelocation not on record	2
Oskarshamn, SE	2
GZUlocation not on record	2
Madrid, ES	2
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Campo Mourão, BR	1
Pamplona, ES	1
John May Museum of Natural Historylocation not on record	1
Moscow State Universitylocation not on record	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Henry Brockhouse Collectionlocation not on record	1
CJBNlocation not on record	1
Stockholm, SE	1
PRClocation not on record	1
Santiago de Compostela, ES	1
UTFPR-CPlocation not on record	1

42 institutions · 541 of 547 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Micromeria graeca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 14.6–15.2

Seasonal swing summer↔winter20.3 °C

Max temp (day)19.5 °C 19.0–20.0

Min temp (night)9.20 °C 9.10–9.30

Precipitation52.8 mm/mo 37.3–68.3

Air humidity55.6 % 53.4–57.7

Moisture balance-41.2 mm/mo -57.6–-24.7

Vapour deficit868 Pa 799–936

Wind speed2.30 m/s 2.10–2.50

Cloud cover39.6 % 38.5–40.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Micromeria graeca

At a glance

Sources10 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Other traits1

Compound class profile2 classes

Documented compounds8 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 959 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions18 of 42 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 959 records