Micromeria cristata

(Hampe) Griseb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Micromeria

At a glance

Occurrence records15

Data sources10

Biological traits12

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Micromeria cristata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility15 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS6 compounds

Occurrence & distributionGBIF15 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 30

01Narrative

Micromeria cristata is a species of flowering plants in the mint family, Lamiaceae. It has been found on dry rocky cliffs above Korita in Albania and on rocky limestone slopes at Lake Ohrid, North Macedonia.Shuka, L. Z.; Tan, K. (2013). "New records for Albania based on taxa from the Prespa National Park". Biodiversity Data Journal 1: e1014. DOI:10.3897/BDJ.1.e1014. The plant flowers mid-June to early July, and fruits from July to August.Shuka, L. Z.; Tan, K. (2013). "New records for Albania based on taxa from the Prespa National Park". Biodiversity Data Journal 1: e1014. DOI:10.3897/BDJ.1.e1014.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Seed mass0.106 mg

Life cycle & reproduction3

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition6 compounds

Compounds documented for Micromeria cristata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavones6

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
Acacetin	present	LOTUS
Apigenin	present	LOTUS
Chrysoeriol	present	LOTUS
Diosmetin	present	LOTUS
Linarin	present	LOTUS
Luteolin 7-diglucoside	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Micromeria cristata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

matKAY840156.1 ↗2 429 bpYugoslavia

ACGT

GGATGAAGTGACGGATTCGTCCATACCATTGGTAAACTTTGGAAGACCGCGACTGACCCTGAAAGGGAATAAATGGAAAAAATAGCATGT …

Micromeria cristata trnK gene, intron; and maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Micromeria cristata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome records30–302n range30median30mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 303×CCDB · mediterranean · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74

CCDB · mediterranean

CCDB · ipcn-api-dl — Markova, M. & V. Goranova. 1995. Mediterranean chromosome number reports 5 (435--473). Fl. Medit. 5: 289–317.

CCDB · book-ipcn73-74 — MARKOVA, M.L., & N.T. THU. 1974. In IOPB chromosome number reports XLIII. Taxon 23: 193-196.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type15 records

Wild obs. + sensor4

Museum / vouchered11

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Xiamen, CN	3
LDlocation not on record	2
MAlocation not on record	1
Görlitz, DE	1
Salamanca, ES	1
BRNUlocation not on record	1
PRClocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1

8 institutions · 11 of 11 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Micromeria cristata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)