Microloma sagittatum

(L.) R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Microloma

At a glance

Occurrence records2 094

Data sources9

Biological traits12

DNA specimens2

eDNA detections1

Sources9 archives

Databases and archives Microloma sagittatum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 094 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF2 094 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Microloma sagittatum, the bokhoring, is a species of plant in the family Apocynaceae, that is native to the south-western Cape, South Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max1.5 m

Plant height min0.2 m

Life cycle & reproduction2

Life formclimbing subshrub or shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberobligatory

Elevation max1 300 m

Elevation min10 m

Epiphyteterrestrial

Growth formclimber

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Microloma sagittatum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR392134.1 ↗532 bp

ACGT

CCTTGTACAAATGACCAGCGAACACGTTCTGAAATTTGCATCGGGTGTTGGGATAAACCTTTCGCTTGTTGCCCCTTTGCTTGGTCGGTC …

Microloma sagittatum voucher Muasya & Zhigila 7889 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcLa★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Microloma sagittatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–222n range21median20mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Albers, F., S. Liede & U. Meve. 1992. Deviating chromosome numbers in Asclepiadaceae. Nordic J. Bot. 13: 37–39.

2n 221×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Wanntorp, H. E. 1988. The genus Microloma (Asclepiadaceae). Opera Bot. 98: 1–69.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 094 records

Wild obs. + sensor1 713

Museum / vouchered381

Range

Area of Occupancy AOO4 452 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 1 084≤1 km 169≤10 km 65>10 km 116

1 434 georeferenced · 279 without coordinates

Open the mapobservation + sensor1 713

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤1 km 7≤10 km 1>10 km 1

9 georeferenced · 372 without coordinates

Open the institutions mapphysical evidence381

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	224
Cape Town, ZA	99
Saint Louis, US	14
MeiseBGlocation not on record	6
Stockholm, SE	4
GHPG$location not on record	2
University of Stellenboschlocation not on record	2
Chicago, US	1
University of Johannesburglocation not on record	1
Moscow State Universitylocation not on record	1
Kew, GB	1
Philadelphia, US	1
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	1
Canberra, AU	1

14 institutions · 358 of 381 vouchered records shown · 23 without an institution code

09Environmental DNA1 detections

Where the DNA of Microloma sagittatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter9.20 °C

Max temp (day)23.2 °C

Min temp (night)9.70 °C

Precipitation15.0 mm/mo

Air humidity54.8 %

Moisture balance-89.7 mm/mo

Vapour deficit807 Pa

Wind speed2.90 m/s

Cloud cover9.10 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Microloma sagittatum

At a glance

Sources9 archives

Size & morphology2

Life cycle & reproduction2

Diet & foraging1

Habitat & environment7

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 094 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 094 records