Microlinyphia dana

(Chamberlin & Ivie, 1943) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Microlinyphia

At a glance

Occurrence records414

Data sources9

Biological traits40

DNA specimens130

eDNA detections130

Sources9 archives

Databases and archives Microlinyphia dana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility414 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI130 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics130 specimens↗

World Spider Trait DBMasaryk University40 traits · 4 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources40 traits

Occurrence & distributionGBIF414 records

Environmental DNA1 datasets · 2 countries130 detections

DNA & barcodingBOLD130 specimens

01Narrative

Microlinyphia dana is a species of sheetweb spider in the family Linyphiidae. It is found in the United States and Canada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWolff et al. 2022Comstock 1940van Helsdingen 1970Chamberlin & Ivie 1943

Morphometry36

ALE0.11 mm

AME0.11 mm

Abdomen height2.08 mm

Abdomen length2.65 mm

Abdomen width1.66 mm

Body length4.8 mm

Cephalothorax height1.29 mm

Cephalothorax length1.96 mm

Cephalothorax width1.35 mm

Chelicerae basal part (paturon) length0.985 mm

Femur I length2.65 mm

Femur II length2.4 mm

Femur III length1.7 mm

Femur IV length2.25 mm

Leg I length10 mm

Leg II length8.75 mm

Leg III length5.85 mm

Leg IV length7.9 mm

Metatarsus I length2.7 mm

Metatarsus II length2.35 mm

Metatarsus III length1.55 mm

Metatarsus IV length2.25 mm

PLE0.098 mm

PME0.133 mm

Patella I length0.6 mm

Patella II length0.55 mm

Patella III length0.45 mm

Patella IV length0.5 mm

Tarsus I length1.4 mm

Tarsus II length1.2 mm

Tarsus III length0.8 mm

Tarsus IV length1 mm

Tibia I length2.65 mm

Tibia II length2.25 mm

Tibia III length1.35 mm

Tibia IV length1.9 mm

Predation2

Hunting guild 2aerial web builder

Web buildingyes

Biomechanics1

'Primary mode of locomotionhanging

Morphology1

Cribellumabsent

05DNA & barcoding130 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Microlinyphia dana has left across the world's sequence archives.

At a glance

DNA specimens130

BINs1

Marker genes1

eDNA detections130

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus130 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

190Amostly conserved

226Tvariable

229Amostly conserved

235Tvariable

433Avariable

478Amostly conserved

565Avariable

571Tmostly conserved

581Tmostly conserved

AACTTTGTATTTTATTTTTGGGGCTTGAGCTGCCATAGTAGGAACTGCTATAAGAGTTTTAATTCGAATTGAGCTTGGACAAACAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.74%

Haplotypes15

BIN1

Most divergent pair1.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Microlinyphia impigrasame genus10.9%Linyphia hortensissame family10.9%Linyphia triangularissame family11.4%Linyphia tenuipalpissame family11.9%Estrandia grandaevasame family12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type414 records

Wild obs. + sensor129

Museum / vouchered285

Range

Area of Occupancy AOO708 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 69≤1 km 21≤10 km 3>10 km 4

97 georeferenced · 32 without coordinates

Open the mapobservation + sensor129

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy98% within 1 km

≤100 m 81≤1 km 31≤10 km 2

114 georeferenced · 171 without coordinates

Open the institutions mapphysical evidence285

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	114
University of Guelph, Centre for Biodiversity Genomicslocation not on record	56
Denver, US	26
Vancouver, CA	3

4 institutions · 199 of 285 vouchered records shown · 86 without an institution code

09Environmental DNA130 detections

Where the DNA of Microlinyphia dana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found130

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 130 detections have coordinates

Open the map2 countries0

Wetlandold forestForest5. Wetlands (inland)BeachBedrock, Blanket Bog

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 10.1–15.6

Seasonal swing summer↔winter10.3 °C

Max temp (day)16.2 °C 12.7–18.6

Min temp (night)12.4 °C 7.60–13.4

Precipitation93.9 mm/mo 35.5–163

Air humidity65.8 % 60.3–68.1

Moisture balance19.5 mm/mo

Vapour deficit534 Pa 436–634

Wind speed2.60 m/s

Cloud cover39.0 % 36.7–43.5

CHELSA 1981–2010, ~9 km grid, at location & month of 129 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)