Microdracoides squamosa

Hua · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Microdracoides

At a glance

Occurrence records40

Data sources6

Biological traits10

DNA specimens0

eDNA detections2

Sources6 archives

Databases and archives Microdracoides squamosa's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility40 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF40 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingNCBIsequences

01Narrative

Microdracoides is a monotypic genus of flowering plants belonging to the family Cyperaceae. The only species is Microdracoides squamosa. Its native range is Western and Western Central Tropical Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max1 m

Life cycle & reproduction3

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Microdracoides squamosa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

rbcLAM999849.1 ↗1 342 bp

ACGT

AAGTGTTGGATTTAAAGCTGGGGTTAAAGATTATAAACTTACTTATTATACTCCTCAGTACGAAACCAAGGATACTGATATCTTGGCAGC …

Microdacoides squamosus chloroplast partial rbcL gene for ribulose-bisphosphate carboxylase

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2

plant barcode

08Occurrence & distribution

Record type40 records

Wild obs. + sensor4

Museum / vouchered36

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Forest Herbarium Ibadan (FHI)location not on record	6
Kew, GB	6
MeiseBGlocation not on record	2
BRLUlocation not on record	1
Moscow State Universitylocation not on record	1
CMULlocation not on record	1
Saint Louis, US	1

7 institutions · 18 of 36 vouchered records shown · 18 without an institution code

09Environmental DNA2 detections

Where the DNA of Microdracoides squamosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)