Microcnemum coralloides

(Loscos & Pardo) Buen · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Microcnemum

At a glance

Occurrence records275

Data sources7

Biological traits5

DNA specimens6

eDNA detections6

Sources7 archives

Databases and archives Microcnemum coralloides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility275 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources5 traits

Occurrence & distributionGBIF275 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Microcnemum is een geslacht uit de amarantenfamilie (Amaranthaceae). Het geslacht telt een soort die een disjunct verspreidingsgebied kent. De soort komt voor in Spanje en daarnaast van in Turkije tot in Iran.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction1

Life formannual

Habitat & environment3

Climatetemperate

Growth formhydrohalophyte

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Microcnemum coralloides has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences10

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSON817250.1 ↗582 bpSpain · 2018

ACGT

CAGATTGACCAGCGAACATGTTTATCATGCGGGGTTTGGGTGCTGGAGTGACCTGTGGTTGCCATCTCCCATCCCCGGCCTGGGGGTAGC …

Microcnemum coralloides voucher MAF 178622 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL1★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Microcnemum coralloides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome records18–182n range18median18mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 185×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015

CCDB · iber-fl — Datos cariolgicos y taxonmicos sobre las Salicorninae A.J. Scott ibricas. Castroviejo, S. & P. Coello.Anales Jard. Bot. Madrid37(1): 41-73(1980).

CCDB · ipcn-api-dl — Castroviejo, S. & P. Coello. 1980. Datos cariologicos y taxonomicos sobre las Salicorniinae A.J. Scott ibericas. Anales Jard. Bot. Madrid 37: 41–73.

CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid

CCDB · CromoCat 2015 — Castroviejo, S. & Coello, P. (1980). Datos cariológicos y taxonómicos sobre las Salicorniinae A.J. Scott ibéricas. Anales Jard. Bot. Madrid 37(1): 41-73.

08Occurrence & distribution

Record type275 records

Wild obs. + sensor211

Museum / vouchered61

Cultivated / captive1

Other2

Origin

Native9

Range

Area of Occupancy AOO460 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy16% within 1 km

≤100 m 4≤1 km 25≤10 km 143>10 km 9

181 georeferenced · 30 without coordinates

Open the mapobservation + sensor211

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 1≤1 km 20≤10 km 8

29 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence61

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MAlocation not on record	20
València, ES	13
Salamanca, ES	3
Pamplona, ES	3
Museo Achille Folettolocation not on record	3
BClocation not on record	3
BDBClocation not on record	2
Alicante, ES	2
Phyletisches Museum Jenalocation not on record	2
Granada, ES	2
Moscow State Universitylocation not on record	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
ISAlocation not on record	1
College of the Atlantic, Museumlocation not on record	1
Entomological Society of Latvialocation not on record	1

15 institutions · 58 of 61 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Microcnemum coralloides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–15.2

Seasonal swing summer↔winter21.1 °C

Max temp (day)20.1 °C

Min temp (night)9.00 °C

Precipitation33.4 mm/mo

Air humidity52.9 %

Moisture balance-61.7 mm/mo

Vapour deficit953 Pa

Wind speed2.00 m/s

Cloud cover38.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)