Microcachrys tetragona

(Hook.) Hook.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Podocarpaceae/Microcachrys

At a glance

Occurrence records632

Data sources12

Biological traits22

DNA specimens10

eDNA detections10

Sources12 archives

Databases and archives Microcachrys tetragona's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility632 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF632 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB4.1 Gbp

01Narrative

Microcachrys tetragona, the creeping pine or creeping strawberry pine, is a species of dioecious conifer belonging to the podocarp family (Podocarpaceae).Christopher N. Page. 1990. "Podocarpaceae" pages 332-346. In: Klaus Kubitzki (general editor); Karl U. Kramer and Peter S. Green (volume editors) The Families and Genera of Vascular Plants volume I. Springer-Verlag: Berlin;Heidelberg, Germany. It is the sole species of the genus Microcachrys.James E. Eckenwalder. 2009. Conifers of the World. Timber Press: Portland, OR, USA. . The plant is endemic to western Tasmania, where it is a low shrub growing to 1 m tall at high altitudes. Its leaves are scale-like, arranged (unusually for the Podocarpaceae) in opposite decussate pairs, superficially resembling those of the unrelated Diselma archeri (Cupressaceae). It shares the common name Creeping pine with several other plants. Females produce tiny, red, edible berries in summer. Microcachrys tetragona foliage.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology7

Leaf length1 mm

Leaf size0.785 mm²

Leaf width1 mm

Plant height0.3 m

Seed mass1.5 mg

⚠ sources differ — TRY: 1.5 mg · AusTraits: 1.67 mg · GIFT: 22.05 mg

Seed mass max22.05 mg

Seed mass min22.05 mg

Life cycle & reproduction7

Deciduousnessevergreen

Dispersal typeanimal

Life formsubshrub or shrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Resprouting capacityfire_killed

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Fruit typestrobilus

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

03Chemical composition1 compounds

Compounds documented for Microcachrys tetragona across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Pimarane and Isopimarane diterpenoids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
ent-Sandaracopimaradiene		present	LOTUS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Microcachrys tetragona has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes4

GenBank sequences10

eDNA detections10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF713873.1 ↗434 bp

ACGT

TGCAGAATCCCGTGAATCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCTCCGGTCGAGGGCACGTCTGCCTGGGCGACGCATTCGCC …

Microcachrys tetragona isolate P232 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Microcachrys tetragona carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 058 700 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Microcachrys tetragona4.06 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 301×CCDB · Cave1958

CCDB · Cave1958 — Hair & Beuzen. 1958a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.795 ↗

07Deep time~102 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin102 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard periods (Jurassic, Cretaceous…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. The dashed rules marked ✦ are the five great mass extinctions. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock originmass extinction

08Occurrence & distribution

Record type632 records

Wild obs. + sensor349

Museum / vouchered276

Cultivated / captive7

Origin

Native37

Range

Area of Occupancy AOO632 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 227≤1 km 32≤10 km 47>10 km 12

318 georeferenced · 31 without coordinates

Open the mapobservation + sensor349

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 3≤1 km 119≤10 km 91>10 km 8

221 georeferenced · 55 without coordinates

Open the institutions mapphysical evidence276

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 5 without coordinates

Open the mapnot free-living7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hobart, AU	104
Mount Annan, AU	38
Museo Entomologico de Leonlocation not on record	33
Canberra, AU	27
Kew, GB	16
Adelaide, AU	12
QVMAGlocation not on record	9
Edinburgh, GB	6
Brisbane, AU	5
Claremont, US	4
Bronx, US	3
John T. Waterhouse Herbariumlocation not on record	3
Armidale, AU	3
Wellington, NZ	2
Parkville, AU	2
Canadian Department of Agriculturelocation not on record	2
MAlocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Davis, US	1
Vancouver, CA	1
Honolulu, US	1

21 institutions · 274 of 276 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA10 detections

Where the DNA of Microcachrys tetragona was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)