Microbotryum violaceum

(Pers.) G.Deml & Oberw. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Microbotryomycetes/Microbotryales/Microbotryaceae/Microbotryum

At a glance

Occurrence records2 994

Data sources10

Biological traits0

DNA specimens11

eDNA detections62

Sources10 archives

Databases and archives Microbotryum violaceum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 994 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI62 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF2 994 records

Environmental DNA7 datasets · 3 countries62 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceGoaT · NCBI25 Mbp

01Narrative

Microbotryum violaceum, also known as the anther smut fungus, was formerly known as Ustilago violacea. It is a Basidiomycete obligate parasite of many Caryophyllaceae. But it has now separated into many species due to its host specificity. Meiosis in M. violaceum produces a tetrad of four haploid meiotic products. Pairwise intra-tetrad mating can occur between these meiotic products.Hood ME, Antonovics J. Intratetrad mating, heterozygosity, and the maintenance of deleterious alleles in Microbotryum violaceum (=Ustilago violacea). Heredity (Edinb). 2000 Sep;85 Pt 3:231-41.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition1 compounds

Compounds documented for Microbotryum violaceum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Macrolide lactones1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
CID 6444323		present	LOTUS

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Microbotryum violaceum has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes2

GenBank sequences10

eDNA detections62

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPV124722.1 ↗576 bpUnited Kingdom · 2016

ACGT

CATTAGTGAATTTATAGCGTACCTGTTTAACCAGGGCGTGACCTCTCACTTTTCAAACTCTGTGCACTCTAATGGGGGGGCCAAGGAAAG …

Microbotryum violaceum voucher K-M000205629 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Microbotryum violaceum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size25 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Microbotryum violaceum0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness97.5% BUSCO

08Occurrence & distribution

Record type2 994 records

Wild obs. + sensor1 911

Museum / vouchered1 045

Other38

Origin

Native42

Range

Area of Occupancy AOO5 996 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy8% within 1 km

≤100 m 59≤1 km 93≤10 km 1 744>10 km 4

1 900 georeferenced · 11 without coordinates

Open the mapobservation + sensor1 911

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 10≤1 km 211≤10 km 58>10 km 20

299 georeferenced · 746 without coordinates

Open the institutions mapphysical evidence1 045

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	214
LDlocation not on record	123
Helsinki, FI	62
Görlitz, DE	45
Karlsruhe, DE	41
Stockholm, SE	33
DPIlocation not on record	31
MAlocation not on record	21
CA	21
MeiseBGlocation not on record	16
BDBClocation not on record	15
WU-MYClocation not on record	14
Kew, GB	12
Bernard Price Institute for Palaeontological Researchlocation not on record	9
Bronx, US	8
Museo Entomologico de Leonlocation not on record	6
Berlin, DE	5
Champaign, US	5
Pullman, US	4
TROMlocation not on record	4
University of Tennessee at Chattanoogalocation not on record	3
Mlocation not on record	3
GZUlocation not on record	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	1
Stockholm, SE	1
Uppsala, SE	1
	1
Gijón, ES	1
Trondheim, NO	1

29 institutions · 703 of 1 045 vouchered records shown · 342 without an institution code

09Environmental DNA62 detections

Where the DNA of Microbotryum violaceum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found62

Studies independent surveys7

Countries3

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 62 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature17.2 °C 17.2–18.1

pH6.80 6.20–8.30

Conductivity119 µS/cm 31.0–49,300

Salinity34.8 PSU 34.6–38.7

Organic carbon3.35 % 0.74–4.14

Nitrate-N12.5 mg/kg 1.00–73.0

Nitrate0.358 µmol/L 0.109–0.627

Phosphorus35.0 mg/kg 6.00–100

Clay12.6 % 10.0–40.4

Sand74.0 % 41.4–87.6

Depth0 m 0–3.00

Coastal waterSedimentSoilChromosolsFerrosolRudosolSodosolTenosol

46 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 13.0–19.6

Seasonal swing summer↔winter9.30 °C

Max temp (day)17.8 °C 15.4–22.1

Min temp (night)11.1 °C 8.40–17.8

Precipitation86.8 mm/mo 57.0–116

Air humidity57.5 % 55.6–60.7

Moisture balance5.00 mm/mo -78.0–65.2

Vapour deficit709 Pa 643–902

Wind speed2.90 m/s 2.40–6.10

Cloud cover24.9 % 21.3–26.3

CHELSA 1981–2010, ~9 km grid, at location & month of 48 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Microbotryum violaceum

At a glance

Sources10 archives

Compound class profile1 class

Documented compounds1 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 994 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type2 994 records