Microbotryum succisae — The Life Data

Fungi/Basidiomycota/Microbotryomycetes/Microbotryales/Microbotryaceae/Microbotryum

At a glance

Occurrence records93

Data sources4

Biological traits0

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Microbotryum succisae's data was compiled from.

GBIFGlobal Biodiversity Information Facility93 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF93 records

DNA & barcodingNCBIsequences

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Microbotryum succisae has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN657204.1 ↗277 bpGermany · 1987

ACGT

TCTTGGTCATTTAGAGGAAGTAAAAGTTGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATTTATAGCGTACCTGT …

Microbotryum succisae voucher M0066045 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS2

fungal barcode

08Occurrence & distribution

Record type93 records

Wild obs. + sensor70

Museum / vouchered23

Range

Area of Occupancy AOO280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy35% within 1 km

≤100 m 14≤1 km 10≤10 km 44

68 georeferenced · 2 without coordinates

Open the mapobservation + sensor70

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 2≤10 km 1

3 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Görlitz, DE	5
Karlsruhe, DE	4
Stockholm, SE	3
LDlocation not on record	3
Helsinki, FI	3
Kew, GB	2
MAlocation not on record	1
Mlocation not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1

9 institutions · 23 of 23 vouchered records shown