Microbotryum scabiosae

(Sowerby) G.Deml & Prillinger · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Microbotryomycetes/Microbotryales/Microbotryaceae/Microbotryum

At a glance

Occurrence records217

Data sources8

Biological traits0

DNA specimens2

eDNA detections6

Sources8 archives

Databases and archives Microbotryum scabiosae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility217 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF217 records

Environmental DNA3 datasets · 3 countries6 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT · NCBI≈23 Mbp

01Narrative

Microbotryum scabiosae est une espèce de champignons basidiomycètes phytoparasites de la famille des Microbotryaceae et du genre Microbotryum. Ce microchampignon européen provoque la maladie cryptogamique de la rouille nommée « charbon des anthères » sur le genre Knautia, notamment la Knautie des champs, et pas sur Scabiosa comme son nom l'indiquerait.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Microbotryum scabiosae has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences7

eDNA detections6

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKJ778632.1 ↗610 bp

ACGT

GATCATTAGTGAAAAAATAGCGTACCTGTTTAACCAGGGCGTGACCTCTCACTTTTTCAAACTCTGTGCACTTCAAATTTGCTGGCTATA …

Microbotryum scabiosae culture CBS:677.93 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Microbotryum scabiosae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈22 775 219 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Microbotryum scabiosae0.02 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type217 records

Wild obs. + sensor109

Museum / vouchered106

Other2

Range

Area of Occupancy AOO632 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 49≤1 km 7≤10 km 36>10 km 3

95 georeferenced · 14 without coordinates

Open the mapobservation + sensor109

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 3≤10 km 1

4 georeferenced · 102 without coordinates

Open the institutions mapphysical evidence106

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Görlitz, DE	57
LDlocation not on record	18
Stockholm, SE	5
Berlin, DE	4
BDBClocation not on record	3
Pullman, US	2
WU-MYClocation not on record	2
TROMlocation not on record	1
Zürich, CH	1
Kew, GB	1
Olocation not on record	1
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1

13 institutions · 97 of 106 vouchered records shown · 9 without an institution code

09Environmental DNA6 detections

Where the DNA of Microbotryum scabiosae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys3

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

Palearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 12.7–16.8

Seasonal swing summer↔winter20.9 °C

Max temp (day)20.2 °C 17.6–20.9

Min temp (night)11.6 °C 6.30–12.4

Precipitation115 mm/mo 54.3–151

Air humidity61.0 % 54.5–62.4

Moisture balance-6.10 mm/mo -57.0–30.3

Vapour deficit743 Pa 694–844

Wind speed1.90 m/s 1.70–2.50

Cloud cover30.6 % 30.3–38.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)