Microberlinia brazzavillensis

A.Chev. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Microberlinia

At a glance

Occurrence records153

Data sources9

Biological traits11

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Microberlinia brazzavillensis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility153 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF153 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Microberlinia brazzavillensis is a tree in the family Leguminosae, found in West Africa. It is also called zebrano, zingana, and allen ele, and is commonly sold in the US as zebrawood. The tree is tall and straight, growing up to 40 m in height with a diameter of up to 1 m. The flower has white petals and, as other legumes do, the tree produces pods. Concern is expressed due to the tree's rarity in some areas of its native tropical habitat in Gabon and Cameroon, typically less than one tree per square kilometre. It is listed on The IUCN Red List of Threatened Species as vulnerable The wood is pale yellow to almost white with dark streaks, and it takes a nice polish. The wood is valued by some for its striped figure and is used in furniture. The wood is very tough and durable, and it can be used for objects such as tool handles and sporting equipment. It is resistant to termites and wood-rotting fungi.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height35 m

⚠ sources differ — GIFT: 35 m · TRY: 40 m

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Habitat & environment4

Climatewet tropical

Climberself-supporting

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Wood density692 mg/cm³

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Microberlinia brazzavillensis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences5

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSAF513697.1 ↗800 bp

ACGT

GATCGCGGCGACGTGGGCGGTCCGCCGCCGGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAG …

Microberlinia brazzavillensis 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS2★ITS2

plant barcodefungal barcode

07Deep time~12.3 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin12.3 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type153 records

Wild obs. + sensor8

Museum / vouchered145

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 145 records without

Open the institutions mapphysical evidence145

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LBVlocation not on record	26
Herbier National du Gabonlocation not on record	18
Saint Louis, US	14
Kew, GB	8
Plocation not on record	6
WAGlocation not on record	4
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	3
Paris, FR	3
Clocation not on record	3
Stockholm, SE	2
Zlocation not on record	2
Pretoria, ZA	2
MAlocation not on record	2
Centre D'Etude sur les Ressources Végétaleslocation not on record	2
University of Oxfordlocation not on record	2
Bronx, US	1
Botanical Garden "Anastasie Fatu" of Iasilocation not on record	1
Montpellier, FR	1
Yaoundé, CM	1
Llocation not on record	1
IPHAMETRAlocation not on record	1
BMlocation not on record	1
Elocation not on record	1
EAlocation not on record	1
Glocation not on record	1
Wlocation not on record	1
South Kensington, GB	1
Edinburgh, GB	1

28 institutions · 110 of 145 vouchered records shown · 35 without an institution code

09Environmental DNA2 detections

Where the DNA of Microberlinia brazzavillensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)